Mutagenetix > Incidental Mutation

Incidental Mutation 'R9545:Wdfy3'

720045

Institutional Source

Beutler Lab

Gene Symbol

Wdfy3

Ensembl Gene

ENSMUSG00000043940

Gene Name

WD repeat and FYVE domain containing 3

Synonyms

D5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R9545 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101832956-102069921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 101953091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Arginine at position 220 (I220R)

Ref Sequence

ENSEMBL: ENSMUSP00000052607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000174698] [ENSMUST00000212024]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: I220R

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
low complexity region	1408	1417	N/A	INTRINSIC
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2517	2638	3.1e-17	PFAM
Beach	2677	2958	2.54e-217	SMART
WD40	3054	3088	1.28e1	SMART
WD40	3098	3137	7.73e-6	SMART
WD40	3140	3178	8.29e-1	SMART
WD40	3183	3227	3.09e-1	SMART
low complexity region	3253	3274	N/A	INTRINSIC
low complexity region	3307	3318	N/A	INTRINSIC
WD40	3381	3420	1.33e1	SMART
FYVE	3428	3497	3.18e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000174598
AA Change: I220R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: I220R

Domain	Start	End	E-Value	Type
low complexity region	463	481	N/A	INTRINSIC
Pfam:DUF4704	1392	1597	6.6e-11	PFAM
low complexity region	1629	1644	N/A	INTRINSIC
Pfam:PH_BEACH	2588	2656	1.8e-14	PFAM
Beach	2695	2976	2.54e-217	SMART
WD40	3072	3106	1.28e1	SMART
WD40	3116	3155	7.73e-6	SMART
WD40	3158	3196	8.29e-1	SMART
WD40	3201	3245	3.09e-1	SMART
low complexity region	3271	3292	N/A	INTRINSIC
low complexity region	3325	3336	N/A	INTRINSIC
WD40	3399	3438	1.33e1	SMART
FYVE	3446	3515	3.18e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000174698
AA Change: I220R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000134541
Gene: ENSMUSG00000043940
AA Change: I220R

Domain	Start	End	E-Value	Type
Blast:WD40	235	281	2e-21	BLAST
low complexity region	463	481	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000212024
AA Change: I220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,466,538	L4100Q	probably damaging	Het
Acss2	C	A	2: 155,561,796	P652T	probably damaging	Het
Agl	A	T	3: 116,788,689	I228N	possibly damaging	Het
Ap5m1	C	G	14: 49,073,814	Q114E	possibly damaging	Het
Apob	C	T	12: 7,983,890	T201I	possibly damaging	Het
As3mt	G	A	19: 46,707,794	V14I	probably damaging	Het
Atp1a4	T	C	1: 172,250,897	N258S	probably benign	Het
Atxn1l	C	T	8: 109,732,056	V525M	probably damaging	Het
B020004J07Rik	C	A	4: 101,835,900	C301F	probably damaging	Het
B4galnt4	T	C	7: 141,064,891	V208A	probably benign	Het
Bet1	A	T	6: 4,077,973	S89T	probably damaging	Het
Cdhr1	T	G	14: 37,095,059	N115T	possibly damaging	Het
Cstf1	C	T	2: 172,370,965		probably benign	Het
Dcdc2c	G	T	12: 28,552,296	T3K	possibly damaging	Het
Deup1	C	T	9: 15,607,824	E129K	possibly damaging	Het
Dgkg	T	C	16: 22,566,418	E446G	possibly damaging	Het
Dolk	A	G	2: 30,286,004	S10P	probably benign	Het
Gm1110	T	C	9: 26,889,681	T406A	probably benign	Het
Gm13723	T	C	2: 86,873,271	I151V	probably benign	Het
Gm8439	C	T	4: 120,588,760		probably benign	Het
Gna12	A	G	5: 140,760,820	I290T	probably damaging	Het
Gtf2h1	T	C	7: 46,808,688		probably null	Het
Il4	C	T	11: 53,614,010	R76H	probably damaging	Het
Itgal	T	C	7: 127,330,250	F1113S	probably damaging	Het
Kcnc3	T	C	7: 44,595,933	L549P	probably damaging	Het
Klhl26	T	C	8: 70,451,514	D582G	probably damaging	Het
Lhfpl5	C	A	17: 28,580,105	A196D	probably damaging	Het
Lipm	T	C	19: 34,112,992	M191T	probably benign	Het
Lrp6	A	G	6: 134,506,366	Y459H	probably damaging	Het
Lzts1	C	A	8: 69,138,634	K287N	probably damaging	Het
Mfsd14b	C	A	13: 65,073,600	V293L	probably benign	Het
Mmp23	T	A	4: 155,651,523	Q224L	probably benign	Het
Ms4a13	C	G	19: 11,169,968	S194T	unknown	Het
Ms4a2	A	G	19: 11,618,873	F164S	probably benign	Het
Nudt15	A	T	14: 73,523,478	C58S	probably damaging	Het
Olfr1502	A	G	19: 13,861,853	H20R	possibly damaging	Het
Olfr225	A	G	11: 59,613,449	T162A	probably benign	Het
Panx3	A	G	9: 37,664,141	F142L	probably damaging	Het
Pik3r6	T	C	11: 68,531,539	Y255H	probably damaging	Het
Pnpt1	T	C	11: 29,156,840	V637A	probably benign	Het
Ppfibp2	T	C	7: 107,738,297	L602P	probably damaging	Het
Ppp2r3a	T	C	9: 101,212,015	N370D	probably benign	Het
Ppp2r5d	A	T	17: 46,684,761	I454N	probably damaging	Het
Radil	A	G	5: 142,506,637	V412A	probably benign	Het
Reep3	TTGACAGATTTCATG	TTG	10: 67,014,924		probably benign	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Spink5	G	A	18: 44,003,195	V558I	possibly damaging	Het
Stxbp5l	T	C	16: 37,208,263		probably null	Het
Svs2	T	A	2: 164,237,393	Q198L	possibly damaging	Het
Thap2	A	T	10: 115,372,929	N95K	probably benign	Het
Tie1	A	G	4: 118,478,915	V718A	probably benign	Het
Trpm3	G	A	19: 22,901,094	E632K	probably benign	Het
Ttc37	T	A	13: 76,111,713	V44D	probably damaging	Het
Ube4a	A	T	9: 44,932,340		probably null	Het
Utp20	A	G	10: 88,782,649	I1163T	probably benign	Het
Vav2	C	T	2: 27,283,339	R491Q	probably damaging	Het
Wapl	T	A	14: 34,677,093	F40I	probably damaging	Het
Xrra1	T	A	7: 99,886,127	V213D	possibly damaging	Het
Zwilch	A	T	9: 64,144,133	V550E	probably damaging	Het

Other mutations in Wdfy3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Wdfy3	APN	5	101915338	critical splice donor site	probably null
IGL00567:Wdfy3	APN	5	101912030	splice site	probably benign
IGL01288:Wdfy3	APN	5	101901991	splice site	probably null
IGL01323:Wdfy3	APN	5	101895064	missense	probably damaging	1.00
IGL01352:Wdfy3	APN	5	101944120	missense	probably damaging	1.00
IGL01553:Wdfy3	APN	5	101900031	missense	probably benign
IGL01560:Wdfy3	APN	5	101957486	nonsense	probably null
IGL01566:Wdfy3	APN	5	101896588	splice site	probably benign
IGL01616:Wdfy3	APN	5	101913260	missense	probably damaging	0.97
IGL01630:Wdfy3	APN	5	101907488	missense	probably benign
IGL01791:Wdfy3	APN	5	101937412	missense	probably damaging	1.00
IGL01820:Wdfy3	APN	5	101924081	missense	probably benign	0.11
IGL01953:Wdfy3	APN	5	101895028	nonsense	probably null
IGL02121:Wdfy3	APN	5	101898510	missense	possibly damaging	0.85
IGL02167:Wdfy3	APN	5	101961157	missense	probably damaging	0.98
IGL02321:Wdfy3	APN	5	101922609	missense	probably damaging	0.99
IGL02327:Wdfy3	APN	5	101888192	missense	probably damaging	1.00
IGL02651:Wdfy3	APN	5	101896475	missense	probably benign	0.37
IGL02801:Wdfy3	APN	5	101907587	missense	probably damaging	1.00
IGL02839:Wdfy3	APN	5	101968920	missense	probably damaging	1.00
IGL02870:Wdfy3	APN	5	101855471	missense	probably damaging	1.00
IGL02997:Wdfy3	APN	5	101894912	missense	probably null	1.00
IGL03064:Wdfy3	APN	5	101935997	missense	probably damaging	0.99
IGL03090:Wdfy3	APN	5	101866276	missense	probably damaging	1.00
IGL03211:Wdfy3	APN	5	101844912	splice site	probably benign
IGL03237:Wdfy3	APN	5	101844599	missense	probably damaging	1.00
IGL03264:Wdfy3	APN	5	101900150	missense	probably damaging	1.00
Esurient	UTSW	5	101944103	missense	probably damaging	1.00
IGL02988:Wdfy3	UTSW	5	101929981	missense	probably damaging	0.99
PIT4382001:Wdfy3	UTSW	5	101882961	frame shift	probably null
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0010:Wdfy3	UTSW	5	101848349	missense	probably damaging	1.00
R0025:Wdfy3	UTSW	5	101845046	missense	probably damaging	0.98
R0031:Wdfy3	UTSW	5	101889295	missense	probably damaging	0.97
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0047:Wdfy3	UTSW	5	101944033	missense	probably damaging	1.00
R0053:Wdfy3	UTSW	5	101844614	missense	probably damaging	0.97
R0078:Wdfy3	UTSW	5	101888105	missense	possibly damaging	0.57
R0147:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0148:Wdfy3	UTSW	5	101917411	missense	probably benign	0.05
R0279:Wdfy3	UTSW	5	101868092	missense	probably damaging	1.00
R0380:Wdfy3	UTSW	5	101948966	missense	probably damaging	0.99
R0472:Wdfy3	UTSW	5	101957443	missense	probably benign	0.13
R0513:Wdfy3	UTSW	5	101890789	missense	probably damaging	0.96
R0594:Wdfy3	UTSW	5	101906185	missense	possibly damaging	0.94
R0601:Wdfy3	UTSW	5	101836172	missense	probably benign
R0787:Wdfy3	UTSW	5	101957388	missense	probably damaging	1.00
R0825:Wdfy3	UTSW	5	101870051	missense	probably damaging	1.00
R1122:Wdfy3	UTSW	5	101882966	missense	possibly damaging	0.94
R1167:Wdfy3	UTSW	5	101875931	missense	probably benign
R1350:Wdfy3	UTSW	5	101898552	missense	probably damaging	1.00
R1422:Wdfy3	UTSW	5	101884214	splice site	probably benign
R1446:Wdfy3	UTSW	5	101851310	missense	possibly damaging	0.68
R1452:Wdfy3	UTSW	5	101937738	missense	possibly damaging	0.91
R1457:Wdfy3	UTSW	5	101917579	missense	possibly damaging	0.57
R1543:Wdfy3	UTSW	5	101844081	missense	probably benign
R1633:Wdfy3	UTSW	5	101981548	missense	probably damaging	1.00
R1643:Wdfy3	UTSW	5	101875915	missense	possibly damaging	0.62
R1656:Wdfy3	UTSW	5	101941447	missense	probably damaging	1.00
R1720:Wdfy3	UTSW	5	101926525	frame shift	probably null
R1743:Wdfy3	UTSW	5	101844065	missense	probably benign	0.12
R1745:Wdfy3	UTSW	5	101948929	missense	probably damaging	0.96
R1850:Wdfy3	UTSW	5	101894999	missense	probably damaging	1.00
R1852:Wdfy3	UTSW	5	101915376	missense	probably benign	0.00
R1854:Wdfy3	UTSW	5	101888186	missense	probably benign	0.05
R1880:Wdfy3	UTSW	5	101917435	missense	probably benign	0.05
R1930:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1931:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R1956:Wdfy3	UTSW	5	101919409	missense	probably benign	0.30
R1965:Wdfy3	UTSW	5	101951312	missense	probably damaging	1.00
R1997:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R2015:Wdfy3	UTSW	5	101860486	missense	probably null	1.00
R2087:Wdfy3	UTSW	5	101895060	missense	probably damaging	1.00
R2156:Wdfy3	UTSW	5	101898425	critical splice donor site	probably null
R2192:Wdfy3	UTSW	5	101907542	missense	possibly damaging	0.55
R2313:Wdfy3	UTSW	5	101889284	missense	probably damaging	1.00
R2332:Wdfy3	UTSW	5	101888323	splice site	probably benign
R2406:Wdfy3	UTSW	5	101888259	missense	probably damaging	1.00
R2679:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R2857:Wdfy3	UTSW	5	101875930	missense	probably benign	0.04
R2937:Wdfy3	UTSW	5	101944122	missense	probably benign	0.07
R3765:Wdfy3	UTSW	5	101861400	missense	probably damaging	1.00
R3795:Wdfy3	UTSW	5	101937600	missense	probably damaging	1.00
R3937:Wdfy3	UTSW	5	101944239	nonsense	probably null
R3947:Wdfy3	UTSW	5	101870036	missense	probably damaging	1.00
R4024:Wdfy3	UTSW	5	101924095	splice site	probably benign
R4065:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4066:Wdfy3	UTSW	5	101922447	missense	probably benign	0.08
R4110:Wdfy3	UTSW	5	101900058	critical splice donor site	probably null
R4235:Wdfy3	UTSW	5	101922634	critical splice acceptor site	probably null
R4420:Wdfy3	UTSW	5	101910984	missense	probably damaging	0.97
R4620:Wdfy3	UTSW	5	101906145	missense	probably damaging	0.99
R4624:Wdfy3	UTSW	5	101884083	missense	possibly damaging	0.52
R4626:Wdfy3	UTSW	5	101943934	missense	probably damaging	1.00
R4727:Wdfy3	UTSW	5	101930028	missense	probably damaging	0.99
R4794:Wdfy3	UTSW	5	101943943	missense	probably damaging	1.00
R4869:Wdfy3	UTSW	5	101894921	missense	probably damaging	0.98
R4971:Wdfy3	UTSW	5	101948972	nonsense	probably null
R4973:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4976:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4984:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R4986:Wdfy3	UTSW	5	101943119	missense	probably benign	0.00
R5068:Wdfy3	UTSW	5	101894937	missense	probably benign	0.15
R5105:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R5120:Wdfy3	UTSW	5	101868106	missense	possibly damaging	0.85
R5134:Wdfy3	UTSW	5	101944103	missense	probably damaging	1.00
R5139:Wdfy3	UTSW	5	101849267	critical splice donor site	probably null
R5235:Wdfy3	UTSW	5	101847106	missense	probably null	0.03
R5303:Wdfy3	UTSW	5	101952983	missense	probably damaging	1.00
R5368:Wdfy3	UTSW	5	101872858	missense	probably damaging	1.00
R5426:Wdfy3	UTSW	5	101919446	missense	probably damaging	0.97
R5442:Wdfy3	UTSW	5	101896559	missense	probably benign	0.04
R5487:Wdfy3	UTSW	5	101836274	missense	probably damaging	1.00
R5509:Wdfy3	UTSW	5	101861448	missense	possibly damaging	0.69
R5877:Wdfy3	UTSW	5	101869989	missense	probably damaging	1.00
R5988:Wdfy3	UTSW	5	101884138	missense	probably benign	0.00
R6017:Wdfy3	UTSW	5	101851359	missense	probably benign	0.01
R6019:Wdfy3	UTSW	5	101849423	missense	probably damaging	1.00
R6199:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6228:Wdfy3	UTSW	5	101898429	missense	possibly damaging	0.67
R6258:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6259:Wdfy3	UTSW	5	101872965	missense	possibly damaging	0.93
R6298:Wdfy3	UTSW	5	101968946	missense	probably damaging	1.00
R6479:Wdfy3	UTSW	5	101913179	missense	probably damaging	1.00
R6550:Wdfy3	UTSW	5	101953166	missense	probably benign	0.19
R6776:Wdfy3	UTSW	5	101884045	missense	possibly damaging	0.57
R6793:Wdfy3	UTSW	5	101917431	nonsense	probably null
R6809:Wdfy3	UTSW	5	101923947	missense	possibly damaging	0.63
R6836:Wdfy3	UTSW	5	101952999	missense	probably damaging	1.00
R6897:Wdfy3	UTSW	5	101844066	missense	probably benign	0.10
R7014:Wdfy3	UTSW	5	101894909	critical splice donor site	probably null
R7034:Wdfy3	UTSW	5	101907518	missense	probably damaging	1.00
R7035:Wdfy3	UTSW	5	101855549	missense	probably damaging	1.00
R7135:Wdfy3	UTSW	5	101915437	missense	probably damaging	1.00
R7182:Wdfy3	UTSW	5	101943892	missense	possibly damaging	0.51
R7217:Wdfy3	UTSW	5	101901919	missense	probably damaging	1.00
R7236:Wdfy3	UTSW	5	101836208	missense	probably damaging	0.99
R7264:Wdfy3	UTSW	5	101855523	missense	probably benign	0.02
R7418:Wdfy3	UTSW	5	101957500	missense	probably benign	0.08
R7533:Wdfy3	UTSW	5	101882488	missense	probably benign	0.27
R7543:Wdfy3	UTSW	5	101936059	missense	probably benign	0.00
R7625:Wdfy3	UTSW	5	101855386	splice site	probably null
R7788:Wdfy3	UTSW	5	101848357	missense	probably damaging	0.99
R7810:Wdfy3	UTSW	5	101895074	missense	probably benign	0.01
R7810:Wdfy3	UTSW	5	101951399	nonsense	probably null
R8204:Wdfy3	UTSW	5	101852585	missense	probably benign	0.00
R8268:Wdfy3	UTSW	5	101941610	missense	probably damaging	1.00
R8286:Wdfy3	UTSW	5	101937421	missense	probably benign
R8507:Wdfy3	UTSW	5	101872901	missense	probably benign	0.05
R8514:Wdfy3	UTSW	5	101851353	missense	possibly damaging	0.92
R8536:Wdfy3	UTSW	5	101885198	missense	probably benign
R8710:Wdfy3	UTSW	5	101882483	missense	probably damaging	1.00
R8735:Wdfy3	UTSW	5	101930085	missense	probably benign	0.00
R8749:Wdfy3	UTSW	5	101882580	missense	probably damaging	1.00
R8931:Wdfy3	UTSW	5	101917555	missense	probably benign	0.11
R8943:Wdfy3	UTSW	5	101845365	intron	probably benign
R8968:Wdfy3	UTSW	5	101864117	missense	probably benign	0.05
R8979:Wdfy3	UTSW	5	101948898	missense	probably damaging	1.00
R8998:Wdfy3	UTSW	5	101845192	missense	probably benign	0.05
R9045:Wdfy3	UTSW	5	101847174	missense	probably damaging	1.00
R9068:Wdfy3	UTSW	5	101852585	missense	probably benign	0.34
R9105:Wdfy3	UTSW	5	101882646	missense	probably benign	0.05
R9122:Wdfy3	UTSW	5	101943965	missense	probably damaging	1.00
R9209:Wdfy3	UTSW	5	101930964	missense	probably benign	0.01
R9249:Wdfy3	UTSW	5	101848493	missense	possibly damaging	0.82
R9348:Wdfy3	UTSW	5	101941492	missense	probably damaging	1.00
R9481:Wdfy3	UTSW	5	101852612	missense	probably benign	0.19
R9490:Wdfy3	UTSW	5	101930850	missense	probably benign	0.29
R9524:Wdfy3	UTSW	5	101907467	missense	probably benign	0.03
R9548:Wdfy3	UTSW	5	101885193	missense	probably damaging	0.99
R9636:Wdfy3	UTSW	5	101900033	missense	probably benign
R9750:Wdfy3	UTSW	5	101930094	missense	probably benign	0.00
R9766:Wdfy3	UTSW	5	101895000	missense	possibly damaging	0.90
R9771:Wdfy3	UTSW	5	101852329	missense	probably damaging	1.00
Z1177:Wdfy3	UTSW	5	101900241	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- CAATCTTTGGGCAGCCTAGAG -3'
(R):5'- AGACCCTTTGTAACTTTGTAGATGCC -3'

Sequencing Primer
(F):5'- ATCTTTGGGCAGCCTAGAGATGAC -3'
(R):5'- AGCAGTGATCCTGATATCCTGAC -3'

Posted On

2022-07-18