Incidental Mutation 'R9545:Wapl'
ID 720078
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9545 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 34395885-34469940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34399050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 40 (F40I)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably damaging
Transcript: ENSMUST00000048263
AA Change: F40I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: F40I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090027
AA Change: F40I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: F40I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169910
AA Change: F40I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: F40I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,416,538 (GRCm39) L4100Q probably damaging Het
Acss2 C A 2: 155,403,716 (GRCm39) P652T probably damaging Het
Agl A T 3: 116,582,338 (GRCm39) I228N possibly damaging Het
Ap5m1 C G 14: 49,311,271 (GRCm39) Q114E possibly damaging Het
Apob C T 12: 8,033,890 (GRCm39) T201I possibly damaging Het
As3mt G A 19: 46,696,233 (GRCm39) V14I probably damaging Het
Atp1a4 T C 1: 172,078,464 (GRCm39) N258S probably benign Het
Atxn1l C T 8: 110,458,688 (GRCm39) V525M probably damaging Het
B4galnt4 T C 7: 140,644,804 (GRCm39) V208A probably benign Het
Bet1 A T 6: 4,077,973 (GRCm39) S89T probably damaging Het
Cdhr1 T G 14: 36,817,016 (GRCm39) N115T possibly damaging Het
Cstf1 C T 2: 172,212,885 (GRCm39) probably benign Het
Dcdc2c G T 12: 28,602,295 (GRCm39) T3K possibly damaging Het
Deup1 C T 9: 15,519,120 (GRCm39) E129K possibly damaging Het
Dgkg T C 16: 22,385,168 (GRCm39) E446G possibly damaging Het
Dolk A G 2: 30,176,016 (GRCm39) S10P probably benign Het
Gm1110 T C 9: 26,800,977 (GRCm39) T406A probably benign Het
Gm8439 C T 4: 120,445,957 (GRCm39) probably benign Het
Gna12 A G 5: 140,746,575 (GRCm39) I290T probably damaging Het
Gtf2h1 T C 7: 46,458,112 (GRCm39) probably null Het
Il4 C T 11: 53,504,837 (GRCm39) R76H probably damaging Het
Itgal T C 7: 126,929,422 (GRCm39) F1113S probably damaging Het
Kcnc3 T C 7: 44,245,357 (GRCm39) L549P probably damaging Het
Klhl26 T C 8: 70,904,164 (GRCm39) D582G probably damaging Het
Lhfpl5 C A 17: 28,799,079 (GRCm39) A196D probably damaging Het
Lipm T C 19: 34,090,392 (GRCm39) M191T probably benign Het
Lrp6 A G 6: 134,483,329 (GRCm39) Y459H probably damaging Het
Lzts1 C A 8: 69,591,286 (GRCm39) K287N probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mmp23 T A 4: 155,735,980 (GRCm39) Q224L probably benign Het
Ms4a13 C G 19: 11,147,332 (GRCm39) S194T unknown Het
Ms4a2 A G 19: 11,596,237 (GRCm39) F164S probably benign Het
Nudt15 A T 14: 73,760,918 (GRCm39) C58S probably damaging Het
Or2w25 A G 11: 59,504,275 (GRCm39) T162A probably benign Het
Or8h6 T C 2: 86,703,615 (GRCm39) I151V probably benign Het
Or9i1 A G 19: 13,839,217 (GRCm39) H20R possibly damaging Het
Panx3 A G 9: 37,575,437 (GRCm39) F142L probably damaging Het
Pik3r6 T C 11: 68,422,365 (GRCm39) Y255H probably damaging Het
Pnpt1 T C 11: 29,106,840 (GRCm39) V637A probably benign Het
Ppfibp2 T C 7: 107,337,504 (GRCm39) L602P probably damaging Het
Ppp2r3d T C 9: 101,089,214 (GRCm39) N370D probably benign Het
Ppp2r5d A T 17: 46,995,687 (GRCm39) I454N probably damaging Het
Pramel17 C A 4: 101,693,097 (GRCm39) C301F probably damaging Het
Radil A G 5: 142,492,392 (GRCm39) V412A probably benign Het
Reep3 TTGACAGATTTCATG TTG 10: 66,850,703 (GRCm39) probably benign Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skic3 T A 13: 76,259,832 (GRCm39) V44D probably damaging Het
Spink5 G A 18: 44,136,262 (GRCm39) V558I possibly damaging Het
Stxbp5l T C 16: 37,028,625 (GRCm39) probably null Het
Svs5 T A 2: 164,079,313 (GRCm39) Q198L possibly damaging Het
Thap2 A T 10: 115,208,834 (GRCm39) N95K probably benign Het
Tie1 A G 4: 118,336,112 (GRCm39) V718A probably benign Het
Trpm3 G A 19: 22,878,458 (GRCm39) E632K probably benign Het
Ube4a A T 9: 44,843,638 (GRCm39) probably null Het
Utp20 A G 10: 88,618,511 (GRCm39) I1163T probably benign Het
Vav2 C T 2: 27,173,351 (GRCm39) R491Q probably damaging Het
Wdfy3 A C 5: 102,100,957 (GRCm39) I220R Het
Xrra1 T A 7: 99,535,334 (GRCm39) V213D possibly damaging Het
Zwilch A T 9: 64,051,415 (GRCm39) V550E probably damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34,414,593 (GRCm39) missense probably benign 0.00
IGL00539:Wapl APN 14 34,416,965 (GRCm39) missense probably damaging 1.00
IGL00846:Wapl APN 14 34,414,701 (GRCm39) splice site probably benign
IGL01070:Wapl APN 14 34,467,579 (GRCm39) unclassified probably benign
IGL01516:Wapl APN 14 34,414,038 (GRCm39) missense probably damaging 1.00
IGL02021:Wapl APN 14 34,444,293 (GRCm39) missense probably benign
IGL02209:Wapl APN 14 34,399,218 (GRCm39) missense possibly damaging 0.46
IGL02309:Wapl APN 14 34,466,820 (GRCm39) missense probably damaging 0.98
IGL02471:Wapl APN 14 34,413,877 (GRCm39) missense possibly damaging 0.68
IGL02965:Wapl APN 14 34,461,181 (GRCm39) intron probably benign
IGL03076:Wapl APN 14 34,414,046 (GRCm39) missense probably benign 0.26
IGL03197:Wapl APN 14 34,467,588 (GRCm39) missense possibly damaging 0.77
Mcclintock UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
Tatum UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R0045:Wapl UTSW 14 34,455,751 (GRCm39) missense probably benign 0.18
R0278:Wapl UTSW 14 34,414,569 (GRCm39) missense possibly damaging 0.68
R0335:Wapl UTSW 14 34,414,281 (GRCm39) missense probably damaging 0.99
R1018:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R1295:Wapl UTSW 14 34,446,726 (GRCm39) missense probably damaging 1.00
R1553:Wapl UTSW 14 34,451,147 (GRCm39) missense probably damaging 1.00
R1868:Wapl UTSW 14 34,414,415 (GRCm39) missense probably benign 0.00
R1909:Wapl UTSW 14 34,413,869 (GRCm39) missense probably damaging 1.00
R2698:Wapl UTSW 14 34,413,734 (GRCm39) missense probably benign
R2990:Wapl UTSW 14 34,458,665 (GRCm39) missense probably damaging 0.98
R3121:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3122:Wapl UTSW 14 34,451,172 (GRCm39) missense possibly damaging 0.93
R3147:Wapl UTSW 14 34,447,106 (GRCm39) missense probably damaging 1.00
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3732:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3733:Wapl UTSW 14 34,458,721 (GRCm39) missense probably damaging 0.99
R3878:Wapl UTSW 14 34,414,104 (GRCm39) missense probably damaging 1.00
R4034:Wapl UTSW 14 34,459,871 (GRCm39) missense possibly damaging 0.92
R4934:Wapl UTSW 14 34,414,052 (GRCm39) missense probably benign 0.11
R5079:Wapl UTSW 14 34,446,714 (GRCm39) missense probably damaging 1.00
R5104:Wapl UTSW 14 34,414,016 (GRCm39) nonsense probably null
R5113:Wapl UTSW 14 34,446,711 (GRCm39) missense probably damaging 1.00
R5121:Wapl UTSW 14 34,399,119 (GRCm39) missense probably benign 0.01
R5222:Wapl UTSW 14 34,458,642 (GRCm39) nonsense probably null
R5299:Wapl UTSW 14 34,455,765 (GRCm39) critical splice donor site probably null
R5387:Wapl UTSW 14 34,399,252 (GRCm39) missense probably benign 0.00
R5541:Wapl UTSW 14 34,452,619 (GRCm39) critical splice donor site probably null
R5618:Wapl UTSW 14 34,413,863 (GRCm39) missense possibly damaging 0.91
R5802:Wapl UTSW 14 34,414,277 (GRCm39) missense probably damaging 1.00
R6029:Wapl UTSW 14 34,461,204 (GRCm39) missense possibly damaging 0.94
R6292:Wapl UTSW 14 34,451,152 (GRCm39) missense probably damaging 1.00
R6482:Wapl UTSW 14 34,414,649 (GRCm39) missense probably benign 0.01
R6487:Wapl UTSW 14 34,414,249 (GRCm39) missense probably damaging 1.00
R6925:Wapl UTSW 14 34,399,320 (GRCm39) missense probably benign 0.31
R6937:Wapl UTSW 14 34,444,311 (GRCm39) missense probably benign 0.01
R7080:Wapl UTSW 14 34,414,313 (GRCm39) missense probably benign 0.03
R7203:Wapl UTSW 14 34,458,648 (GRCm39) missense probably benign
R7944:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7945:Wapl UTSW 14 34,399,105 (GRCm39) missense probably benign 0.00
R7969:Wapl UTSW 14 34,452,604 (GRCm39) missense probably damaging 1.00
R8038:Wapl UTSW 14 34,413,639 (GRCm39) missense probably benign
R8053:Wapl UTSW 14 34,414,278 (GRCm39) missense probably damaging 1.00
R8688:Wapl UTSW 14 34,414,549 (GRCm39) missense possibly damaging 0.94
R8864:Wapl UTSW 14 34,414,159 (GRCm39) missense probably benign 0.03
R8988:Wapl UTSW 14 34,451,139 (GRCm39) missense probably damaging 1.00
R9072:Wapl UTSW 14 34,399,417 (GRCm39) missense possibly damaging 0.81
R9197:Wapl UTSW 14 34,444,244 (GRCm39) missense probably damaging 1.00
R9259:Wapl UTSW 14 34,463,052 (GRCm39) missense probably benign 0.00
R9613:Wapl UTSW 14 34,453,520 (GRCm39) missense probably benign 0.29
R9624:Wapl UTSW 14 34,414,063 (GRCm39) missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34,467,647 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CAGACTAGTTTCAAAGTTTGTGTGC -3'
(R):5'- GCAGCCTCACTAGATTCTGAG -3'

Sequencing Primer
(F):5'- AGTTTGTGTGCTGAATGTTGAAAAC -3'
(R):5'- TGAGTAAGATGAACCCTTACCCTGG -3'
Posted On 2022-07-18