Incidental Mutation 'R9545:Wapl'
ID 720078
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene Name WAPL cohesin release factor
Synonyms A530089A20Rik, Wapal
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9545 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 34673928-34747983 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34677093 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 40 (F40I)
Ref Sequence ENSEMBL: ENSMUSP00000040232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]
AlphaFold Q65Z40
Predicted Effect probably damaging
Transcript: ENSMUST00000048263
AA Change: F40I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: F40I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090027
AA Change: F40I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: F40I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169910
AA Change: F40I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: F40I

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,466,538 L4100Q probably damaging Het
Acss2 C A 2: 155,561,796 P652T probably damaging Het
Agl A T 3: 116,788,689 I228N possibly damaging Het
Ap5m1 C G 14: 49,073,814 Q114E possibly damaging Het
Apob C T 12: 7,983,890 T201I possibly damaging Het
As3mt G A 19: 46,707,794 V14I probably damaging Het
Atp1a4 T C 1: 172,250,897 N258S probably benign Het
Atxn1l C T 8: 109,732,056 V525M probably damaging Het
B020004J07Rik C A 4: 101,835,900 C301F probably damaging Het
B4galnt4 T C 7: 141,064,891 V208A probably benign Het
Bet1 A T 6: 4,077,973 S89T probably damaging Het
Cdhr1 T G 14: 37,095,059 N115T possibly damaging Het
Cstf1 C T 2: 172,370,965 probably benign Het
Dcdc2c G T 12: 28,552,296 T3K possibly damaging Het
Deup1 C T 9: 15,607,824 E129K possibly damaging Het
Dgkg T C 16: 22,566,418 E446G possibly damaging Het
Dolk A G 2: 30,286,004 S10P probably benign Het
Gm1110 T C 9: 26,889,681 T406A probably benign Het
Gm13723 T C 2: 86,873,271 I151V probably benign Het
Gm8439 C T 4: 120,588,760 probably benign Het
Gna12 A G 5: 140,760,820 I290T probably damaging Het
Gtf2h1 T C 7: 46,808,688 probably null Het
Il4 C T 11: 53,614,010 R76H probably damaging Het
Itgal T C 7: 127,330,250 F1113S probably damaging Het
Kcnc3 T C 7: 44,595,933 L549P probably damaging Het
Klhl26 T C 8: 70,451,514 D582G probably damaging Het
Lhfpl5 C A 17: 28,580,105 A196D probably damaging Het
Lipm T C 19: 34,112,992 M191T probably benign Het
Lrp6 A G 6: 134,506,366 Y459H probably damaging Het
Lzts1 C A 8: 69,138,634 K287N probably damaging Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Mmp23 T A 4: 155,651,523 Q224L probably benign Het
Ms4a13 C G 19: 11,169,968 S194T unknown Het
Ms4a2 A G 19: 11,618,873 F164S probably benign Het
Nudt15 A T 14: 73,523,478 C58S probably damaging Het
Olfr1502 A G 19: 13,861,853 H20R possibly damaging Het
Olfr225 A G 11: 59,613,449 T162A probably benign Het
Panx3 A G 9: 37,664,141 F142L probably damaging Het
Pik3r6 T C 11: 68,531,539 Y255H probably damaging Het
Pnpt1 T C 11: 29,156,840 V637A probably benign Het
Ppfibp2 T C 7: 107,738,297 L602P probably damaging Het
Ppp2r3a T C 9: 101,212,015 N370D probably benign Het
Ppp2r5d A T 17: 46,684,761 I454N probably damaging Het
Radil A G 5: 142,506,637 V412A probably benign Het
Reep3 TTGACAGATTTCATG TTG 10: 67,014,924 probably benign Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Spink5 G A 18: 44,003,195 V558I possibly damaging Het
Stxbp5l T C 16: 37,208,263 probably null Het
Svs2 T A 2: 164,237,393 Q198L possibly damaging Het
Thap2 A T 10: 115,372,929 N95K probably benign Het
Tie1 A G 4: 118,478,915 V718A probably benign Het
Trpm3 G A 19: 22,901,094 E632K probably benign Het
Ttc37 T A 13: 76,111,713 V44D probably damaging Het
Ube4a A T 9: 44,932,340 probably null Het
Utp20 A G 10: 88,782,649 I1163T probably benign Het
Vav2 C T 2: 27,283,339 R491Q probably damaging Het
Wdfy3 A C 5: 101,953,091 I220R Het
Xrra1 T A 7: 99,886,127 V213D possibly damaging Het
Zwilch A T 9: 64,144,133 V550E probably damaging Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
Tatum UTSW 14 34729195 missense probably damaging 1.00
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5299:Wapl UTSW 14 34733808 critical splice donor site probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
R7944:Wapl UTSW 14 34677148 missense probably benign 0.00
R7945:Wapl UTSW 14 34677148 missense probably benign 0.00
R7969:Wapl UTSW 14 34730647 missense probably damaging 1.00
R8038:Wapl UTSW 14 34691682 missense probably benign
R8053:Wapl UTSW 14 34692321 missense probably damaging 1.00
R8688:Wapl UTSW 14 34692592 missense possibly damaging 0.94
R8864:Wapl UTSW 14 34692202 missense probably benign 0.03
R8988:Wapl UTSW 14 34729182 missense probably damaging 1.00
R9072:Wapl UTSW 14 34677460 missense possibly damaging 0.81
R9197:Wapl UTSW 14 34722287 missense probably damaging 1.00
R9259:Wapl UTSW 14 34741095 missense probably benign 0.00
R9613:Wapl UTSW 14 34731563 missense probably benign 0.29
R9624:Wapl UTSW 14 34692106 missense possibly damaging 0.89
Z1177:Wapl UTSW 14 34745690 makesense probably null
Predicted Primers PCR Primer
(F):5'- CAGACTAGTTTCAAAGTTTGTGTGC -3'
(R):5'- GCAGCCTCACTAGATTCTGAG -3'

Sequencing Primer
(F):5'- AGTTTGTGTGCTGAATGTTGAAAAC -3'
(R):5'- TGAGTAAGATGAACCCTTACCCTGG -3'
Posted On 2022-07-18