Incidental Mutation 'R9546:Dnah14'
ID 720095
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R9546 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to C at 181420992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001] [ENSMUST00000208001] [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000208001
Predicted Effect probably null
Transcript: ENSMUST00000208001
Predicted Effect probably null
Transcript: ENSMUST00000208001
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G A 11: 110,135,042 (GRCm39) Q248* probably null Het
Adgrf4 A T 17: 42,978,283 (GRCm39) C353* probably null Het
Aifm3 T C 16: 17,317,604 (GRCm39) V75A probably benign Het
Apc A G 18: 34,445,311 (GRCm39) K736E possibly damaging Het
Atad2 A G 15: 57,989,973 (GRCm39) S168P probably damaging Het
Ccdc122 T A 14: 77,306,313 (GRCm39) V28E probably damaging Het
Cd5l T C 3: 87,268,201 (GRCm39) V16A probably benign Het
Cdk11b T C 4: 155,733,589 (GRCm39) S682P unknown Het
Chd8 T C 14: 52,453,408 (GRCm39) I1218V probably damaging Het
Clec1b A C 6: 129,382,167 (GRCm39) I215L probably benign Het
Ednrb T C 14: 104,080,459 (GRCm39) I152V probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Epn2 T C 11: 61,437,407 (GRCm39) E55G probably damaging Het
Ern1 A G 11: 106,300,853 (GRCm39) S514P probably benign Het
Fbxo4 G A 15: 3,998,493 (GRCm39) P322S probably damaging Het
Gli3 T A 13: 15,788,443 (GRCm39) D149E probably benign Het
Gm12258 A G 11: 58,749,922 (GRCm39) K366E unknown Het
Gm9195 G T 14: 72,718,347 (GRCm39) H110N possibly damaging Het
Grb10 A G 11: 11,893,919 (GRCm39) I389T probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Hexb T C 13: 97,322,176 (GRCm39) D203G probably damaging Het
Hhatl A G 9: 121,618,649 (GRCm39) Y118H probably damaging Het
Ighv1-69 A G 12: 115,586,885 (GRCm39) F83L possibly damaging Het
Iglon5 A T 7: 43,123,891 (GRCm39) M336K probably benign Het
Iyd A T 10: 3,501,884 (GRCm39) I177F possibly damaging Het
Kdm4c A C 4: 74,323,104 (GRCm39) D1012A possibly damaging Het
Klhl12 T A 1: 134,413,562 (GRCm39) L349Q probably damaging Het
Lrp2 A G 2: 69,287,165 (GRCm39) probably null Het
Mrm2 T A 5: 140,314,334 (GRCm39) H167L probably damaging Het
Mrpl50 T A 4: 49,514,338 (GRCm39) H111L probably damaging Het
Mtcl3 C A 10: 29,022,805 (GRCm39) R51S probably damaging Het
Nags A T 11: 102,039,081 (GRCm39) T471S probably damaging Het
Nod2 A T 8: 89,379,621 (GRCm39) R41W probably benign Het
Notch1 T A 2: 26,371,127 (GRCm39) N320Y probably damaging Het
Nr2c1 A G 10: 94,026,528 (GRCm39) K468E possibly damaging Het
Nsf G A 11: 103,801,275 (GRCm39) Q247* probably null Het
Obsl1 T C 1: 75,482,030 (GRCm39) H280R probably damaging Het
Or4p20 T C 2: 88,254,049 (GRCm39) M107V probably benign Het
Pcdha3 C T 18: 37,079,389 (GRCm39) R44C probably damaging Het
Pcsk4 A G 10: 80,157,741 (GRCm39) S623P possibly damaging Het
Pdcd6ip A T 9: 113,484,174 (GRCm39) Y818N unknown Het
Plk2 T A 13: 110,535,301 (GRCm39) I445K possibly damaging Het
Pramel51 C A 12: 88,148,651 (GRCm39) probably benign Het
Prdm2 A T 4: 142,861,561 (GRCm39) S576R probably damaging Het
Prl3d1 A T 13: 27,278,982 (GRCm39) Y59F probably benign Het
Ptprj C T 2: 90,274,805 (GRCm39) V1186I probably benign Het
Raly AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG AGCAGCAGTGGTGGAGG 2: 154,705,754 (GRCm39) probably benign Het
Ros1 C T 10: 51,994,215 (GRCm39) probably null Het
Ryr2 C T 13: 11,602,101 (GRCm39) probably null Het
Scn7a A T 2: 66,582,603 (GRCm39) I98N possibly damaging Het
Spi1 T A 2: 90,943,617 (GRCm39) S54T probably benign Het
Ssna1 C T 2: 25,162,316 (GRCm39) V16I probably benign Het
Sult3a2 G A 10: 33,655,670 (GRCm39) P103L possibly damaging Het
Syne1 C T 10: 5,193,123 (GRCm39) G3975D probably damaging Het
Tbc1d1 T C 5: 64,330,950 (GRCm39) V43A possibly damaging Het
Tut4 A G 4: 108,370,429 (GRCm39) D776G probably benign Het
Uba5 A G 9: 103,931,567 (GRCm39) S222P probably damaging Het
Vmn2r24 A C 6: 123,764,266 (GRCm39) E381A probably damaging Het
Vmn2r95 G A 17: 18,661,721 (GRCm39) G489D probably benign Het
Wdr17 A T 8: 55,112,735 (GRCm39) F789I probably damaging Het
Xpnpep1 A T 19: 52,990,959 (GRCm39) L422Q probably damaging Het
Zfand3 T A 17: 30,372,302 (GRCm39) H107Q probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAAGTGAAATAGTTGGGCTTTCC -3'
(R):5'- ATTTGCCAGCACGTGTTGTAATC -3'

Sequencing Primer
(F):5'- AAATAGTTGGGCTTTCCTTTGAGC -3'
(R):5'- AGGGTGGTACTTCAGAGA -3'
Posted On 2022-07-18