Incidental Mutation 'R9546:Scn7a'
ID 720098
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R9546 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66582603 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 98 (I98N)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000042792
AA Change: I98N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: I98N

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G A 11: 110,135,042 (GRCm39) Q248* probably null Het
Adgrf4 A T 17: 42,978,283 (GRCm39) C353* probably null Het
Aifm3 T C 16: 17,317,604 (GRCm39) V75A probably benign Het
Apc A G 18: 34,445,311 (GRCm39) K736E possibly damaging Het
Atad2 A G 15: 57,989,973 (GRCm39) S168P probably damaging Het
Ccdc122 T A 14: 77,306,313 (GRCm39) V28E probably damaging Het
Cd5l T C 3: 87,268,201 (GRCm39) V16A probably benign Het
Cdk11b T C 4: 155,733,589 (GRCm39) S682P unknown Het
Chd8 T C 14: 52,453,408 (GRCm39) I1218V probably damaging Het
Clec1b A C 6: 129,382,167 (GRCm39) I215L probably benign Het
Dnah14 A C 1: 181,420,992 (GRCm39) probably null Het
Ednrb T C 14: 104,080,459 (GRCm39) I152V probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Epn2 T C 11: 61,437,407 (GRCm39) E55G probably damaging Het
Ern1 A G 11: 106,300,853 (GRCm39) S514P probably benign Het
Fbxo4 G A 15: 3,998,493 (GRCm39) P322S probably damaging Het
Gli3 T A 13: 15,788,443 (GRCm39) D149E probably benign Het
Gm12258 A G 11: 58,749,922 (GRCm39) K366E unknown Het
Gm9195 G T 14: 72,718,347 (GRCm39) H110N possibly damaging Het
Grb10 A G 11: 11,893,919 (GRCm39) I389T probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Hexb T C 13: 97,322,176 (GRCm39) D203G probably damaging Het
Hhatl A G 9: 121,618,649 (GRCm39) Y118H probably damaging Het
Ighv1-69 A G 12: 115,586,885 (GRCm39) F83L possibly damaging Het
Iglon5 A T 7: 43,123,891 (GRCm39) M336K probably benign Het
Iyd A T 10: 3,501,884 (GRCm39) I177F possibly damaging Het
Kdm4c A C 4: 74,323,104 (GRCm39) D1012A possibly damaging Het
Klhl12 T A 1: 134,413,562 (GRCm39) L349Q probably damaging Het
Lrp2 A G 2: 69,287,165 (GRCm39) probably null Het
Mrm2 T A 5: 140,314,334 (GRCm39) H167L probably damaging Het
Mrpl50 T A 4: 49,514,338 (GRCm39) H111L probably damaging Het
Mtcl3 C A 10: 29,022,805 (GRCm39) R51S probably damaging Het
Nags A T 11: 102,039,081 (GRCm39) T471S probably damaging Het
Nod2 A T 8: 89,379,621 (GRCm39) R41W probably benign Het
Notch1 T A 2: 26,371,127 (GRCm39) N320Y probably damaging Het
Nr2c1 A G 10: 94,026,528 (GRCm39) K468E possibly damaging Het
Nsf G A 11: 103,801,275 (GRCm39) Q247* probably null Het
Obsl1 T C 1: 75,482,030 (GRCm39) H280R probably damaging Het
Or4p20 T C 2: 88,254,049 (GRCm39) M107V probably benign Het
Pcdha3 C T 18: 37,079,389 (GRCm39) R44C probably damaging Het
Pcsk4 A G 10: 80,157,741 (GRCm39) S623P possibly damaging Het
Pdcd6ip A T 9: 113,484,174 (GRCm39) Y818N unknown Het
Plk2 T A 13: 110,535,301 (GRCm39) I445K possibly damaging Het
Pramel51 C A 12: 88,148,651 (GRCm39) probably benign Het
Prdm2 A T 4: 142,861,561 (GRCm39) S576R probably damaging Het
Prl3d1 A T 13: 27,278,982 (GRCm39) Y59F probably benign Het
Ptprj C T 2: 90,274,805 (GRCm39) V1186I probably benign Het
Raly AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG AGCAGCAGTGGTGGAGG 2: 154,705,754 (GRCm39) probably benign Het
Ros1 C T 10: 51,994,215 (GRCm39) probably null Het
Ryr2 C T 13: 11,602,101 (GRCm39) probably null Het
Spi1 T A 2: 90,943,617 (GRCm39) S54T probably benign Het
Ssna1 C T 2: 25,162,316 (GRCm39) V16I probably benign Het
Sult3a2 G A 10: 33,655,670 (GRCm39) P103L possibly damaging Het
Syne1 C T 10: 5,193,123 (GRCm39) G3975D probably damaging Het
Tbc1d1 T C 5: 64,330,950 (GRCm39) V43A possibly damaging Het
Tut4 A G 4: 108,370,429 (GRCm39) D776G probably benign Het
Uba5 A G 9: 103,931,567 (GRCm39) S222P probably damaging Het
Vmn2r24 A C 6: 123,764,266 (GRCm39) E381A probably damaging Het
Vmn2r95 G A 17: 18,661,721 (GRCm39) G489D probably benign Het
Wdr17 A T 8: 55,112,735 (GRCm39) F789I probably damaging Het
Xpnpep1 A T 19: 52,990,959 (GRCm39) L422Q probably damaging Het
Zfand3 T A 17: 30,372,302 (GRCm39) H107Q probably benign Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCTGTAGATATAAGGGGC -3'
(R):5'- GCTATCAGGCAAGTCCAAATATAAG -3'

Sequencing Primer
(F):5'- TCTGTAGATATAAGGGGCGAGATTC -3'
(R):5'- ATAAGTGAAAACTACTCCCTTTGC -3'
Posted On 2022-07-18