Incidental Mutation 'R9546:Prdm2'
ID 720109
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene Name PR domain containing 2, with ZNF domain
Synonyms KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9546 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 143107391-143212995 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 143134991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 576 (S576R)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
AlphaFold A2A7B5
Predicted Effect probably damaging
Transcript: ENSMUST00000105778
AA Change: S576R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: S576R

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G A 11: 110,244,216 Q248* probably null Het
Adgrf4 A T 17: 42,667,392 C353* probably null Het
Aifm3 T C 16: 17,499,740 V75A probably benign Het
Apc A G 18: 34,312,258 K736E possibly damaging Het
Atad2 A G 15: 58,126,577 S168P probably damaging Het
Ccdc122 T A 14: 77,068,873 V28E probably damaging Het
Cd5l T C 3: 87,360,894 V16A probably benign Het
Cdk11b T C 4: 155,649,132 S682P unknown Het
Chd8 T C 14: 52,215,951 I1218V probably damaging Het
Clec1b A C 6: 129,405,204 I215L probably benign Het
Dnah14 A C 1: 181,593,427 probably null Het
Ednrb T C 14: 103,843,023 I152V probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Epn2 T C 11: 61,546,581 E55G probably damaging Het
Ern1 A G 11: 106,410,027 S514P probably benign Het
Fbxo4 G A 15: 3,969,011 P322S probably damaging Het
Gli3 T A 13: 15,613,858 D149E probably benign Het
Gm10436 C A 12: 88,181,881 probably benign Het
Gm12258 A G 11: 58,859,096 K366E unknown Het
Gm9195 G T 14: 72,480,907 H110N possibly damaging Het
Grb10 A G 11: 11,943,919 I389T probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Hexb T C 13: 97,185,668 D203G probably damaging Het
Hhatl A G 9: 121,789,583 Y118H probably damaging Het
Ighv1-69 A G 12: 115,623,265 F83L possibly damaging Het
Iglon5 A T 7: 43,474,467 M336K probably benign Het
Iyd A T 10: 3,551,884 I177F possibly damaging Het
Kdm4c A C 4: 74,404,867 D1012A possibly damaging Het
Klhl12 T A 1: 134,485,824 L349Q probably damaging Het
Lrp2 A G 2: 69,456,821 probably null Het
Mrm2 T A 5: 140,328,579 H167L probably damaging Het
Mrpl50 T A 4: 49,514,338 H111L probably damaging Het
Nags A T 11: 102,148,255 T471S probably damaging Het
Nod2 A T 8: 88,652,993 R41W probably benign Het
Notch1 T A 2: 26,481,115 N320Y probably damaging Het
Nr2c1 A G 10: 94,190,666 K468E possibly damaging Het
Nsf G A 11: 103,910,449 Q247* probably null Het
Obsl1 T C 1: 75,505,386 H280R probably damaging Het
Olfr1181 T C 2: 88,423,705 M107V probably benign Het
Pcdha3 C T 18: 36,946,336 R44C probably damaging Het
Pcsk4 A G 10: 80,321,907 S623P possibly damaging Het
Pdcd6ip A T 9: 113,655,106 Y818N unknown Het
Plk2 T A 13: 110,398,767 I445K possibly damaging Het
Prl3d1 A T 13: 27,094,999 Y59F probably benign Het
Ptprj C T 2: 90,444,461 V1186I probably benign Het
Raly AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG AGCAGCAGTGGTGGAGG 2: 154,863,834 probably benign Het
Ros1 C T 10: 52,118,119 probably null Het
Ryr2 C T 13: 11,587,215 probably null Het
Scn7a A T 2: 66,752,259 I98N possibly damaging Het
Soga3 C A 10: 29,146,809 R51S probably damaging Het
Spi1 T A 2: 91,113,272 S54T probably benign Het
Ssna1 C T 2: 25,272,304 V16I probably benign Het
Sult3a2 G A 10: 33,779,674 P103L possibly damaging Het
Syne1 C T 10: 5,243,123 G3975D probably damaging Het
Tbc1d1 T C 5: 64,173,607 V43A possibly damaging Het
Uba5 A G 9: 104,054,368 S222P probably damaging Het
Vmn2r24 A C 6: 123,787,307 E381A probably damaging Het
Vmn2r95 G A 17: 18,441,459 G489D probably benign Het
Wdr17 A T 8: 54,659,700 F789I probably damaging Het
Xpnpep1 A T 19: 53,002,528 L422Q probably damaging Het
Zcchc11 A G 4: 108,513,232 D776G probably benign Het
Zfand3 T A 17: 30,153,328 H107Q probably benign Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
G1patch:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7936:Prdm2 UTSW 4 143135864 missense probably damaging 0.99
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense probably benign 0.33
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8498:Prdm2 UTSW 4 143180897 missense probably damaging 1.00
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8688:Prdm2 UTSW 4 143111740 missense probably benign
R8732:Prdm2 UTSW 4 143136010 missense probably benign 0.00
R8796:Prdm2 UTSW 4 143133447 missense probably benign 0.33
R8874:Prdm2 UTSW 4 143133215 missense possibly damaging 0.70
R8887:Prdm2 UTSW 4 143134201 missense probably damaging 1.00
R9119:Prdm2 UTSW 4 143131879 nonsense probably null
R9139:Prdm2 UTSW 4 143132182 missense probably benign 0.03
R9165:Prdm2 UTSW 4 143132104 missense possibly damaging 0.73
R9342:Prdm2 UTSW 4 143134908 missense probably damaging 1.00
R9518:Prdm2 UTSW 4 143134009 missense possibly damaging 0.94
R9547:Prdm2 UTSW 4 143134991 missense probably damaging 1.00
R9680:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAGTCCTCCGTTTCTTAGAC -3'
(R):5'- CACCTGATTCCCAAAGGTGTCC -3'

Sequencing Primer
(F):5'- CGTTTCTTAGACTCGCAATTTGTG -3'
(R):5'- TCCTAGAAGAGCCGCAGC -3'
Posted On 2022-07-18