Incidental Mutation 'R9546:Ednrb'
ID 720146
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETR-b, Sox10m1, ETb
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.716) question?
Stock # R9546 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 104052061-104081838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104080459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 152 (I152V)
Ref Sequence ENSEMBL: ENSMUSP00000022718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
AlphaFold P48302
Predicted Effect probably benign
Transcript: ENSMUST00000022718
AA Change: I152V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: I152V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172237
AA Change: I152V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: I152V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227824
AA Change: I152V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G A 11: 110,135,042 (GRCm39) Q248* probably null Het
Adgrf4 A T 17: 42,978,283 (GRCm39) C353* probably null Het
Aifm3 T C 16: 17,317,604 (GRCm39) V75A probably benign Het
Apc A G 18: 34,445,311 (GRCm39) K736E possibly damaging Het
Atad2 A G 15: 57,989,973 (GRCm39) S168P probably damaging Het
Ccdc122 T A 14: 77,306,313 (GRCm39) V28E probably damaging Het
Cd5l T C 3: 87,268,201 (GRCm39) V16A probably benign Het
Cdk11b T C 4: 155,733,589 (GRCm39) S682P unknown Het
Chd8 T C 14: 52,453,408 (GRCm39) I1218V probably damaging Het
Clec1b A C 6: 129,382,167 (GRCm39) I215L probably benign Het
Dnah14 A C 1: 181,420,992 (GRCm39) probably null Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Epn2 T C 11: 61,437,407 (GRCm39) E55G probably damaging Het
Ern1 A G 11: 106,300,853 (GRCm39) S514P probably benign Het
Fbxo4 G A 15: 3,998,493 (GRCm39) P322S probably damaging Het
Gli3 T A 13: 15,788,443 (GRCm39) D149E probably benign Het
Gm12258 A G 11: 58,749,922 (GRCm39) K366E unknown Het
Gm9195 G T 14: 72,718,347 (GRCm39) H110N possibly damaging Het
Grb10 A G 11: 11,893,919 (GRCm39) I389T probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Hexb T C 13: 97,322,176 (GRCm39) D203G probably damaging Het
Hhatl A G 9: 121,618,649 (GRCm39) Y118H probably damaging Het
Ighv1-69 A G 12: 115,586,885 (GRCm39) F83L possibly damaging Het
Iglon5 A T 7: 43,123,891 (GRCm39) M336K probably benign Het
Iyd A T 10: 3,501,884 (GRCm39) I177F possibly damaging Het
Kdm4c A C 4: 74,323,104 (GRCm39) D1012A possibly damaging Het
Klhl12 T A 1: 134,413,562 (GRCm39) L349Q probably damaging Het
Lrp2 A G 2: 69,287,165 (GRCm39) probably null Het
Mrm2 T A 5: 140,314,334 (GRCm39) H167L probably damaging Het
Mrpl50 T A 4: 49,514,338 (GRCm39) H111L probably damaging Het
Mtcl3 C A 10: 29,022,805 (GRCm39) R51S probably damaging Het
Nags A T 11: 102,039,081 (GRCm39) T471S probably damaging Het
Nod2 A T 8: 89,379,621 (GRCm39) R41W probably benign Het
Notch1 T A 2: 26,371,127 (GRCm39) N320Y probably damaging Het
Nr2c1 A G 10: 94,026,528 (GRCm39) K468E possibly damaging Het
Nsf G A 11: 103,801,275 (GRCm39) Q247* probably null Het
Obsl1 T C 1: 75,482,030 (GRCm39) H280R probably damaging Het
Or4p20 T C 2: 88,254,049 (GRCm39) M107V probably benign Het
Pcdha3 C T 18: 37,079,389 (GRCm39) R44C probably damaging Het
Pcsk4 A G 10: 80,157,741 (GRCm39) S623P possibly damaging Het
Pdcd6ip A T 9: 113,484,174 (GRCm39) Y818N unknown Het
Plk2 T A 13: 110,535,301 (GRCm39) I445K possibly damaging Het
Pramel51 C A 12: 88,148,651 (GRCm39) probably benign Het
Prdm2 A T 4: 142,861,561 (GRCm39) S576R probably damaging Het
Prl3d1 A T 13: 27,278,982 (GRCm39) Y59F probably benign Het
Ptprj C T 2: 90,274,805 (GRCm39) V1186I probably benign Het
Raly AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG AGCAGCAGTGGTGGAGG 2: 154,705,754 (GRCm39) probably benign Het
Ros1 C T 10: 51,994,215 (GRCm39) probably null Het
Ryr2 C T 13: 11,602,101 (GRCm39) probably null Het
Scn7a A T 2: 66,582,603 (GRCm39) I98N possibly damaging Het
Spi1 T A 2: 90,943,617 (GRCm39) S54T probably benign Het
Ssna1 C T 2: 25,162,316 (GRCm39) V16I probably benign Het
Sult3a2 G A 10: 33,655,670 (GRCm39) P103L possibly damaging Het
Syne1 C T 10: 5,193,123 (GRCm39) G3975D probably damaging Het
Tbc1d1 T C 5: 64,330,950 (GRCm39) V43A possibly damaging Het
Tut4 A G 4: 108,370,429 (GRCm39) D776G probably benign Het
Uba5 A G 9: 103,931,567 (GRCm39) S222P probably damaging Het
Vmn2r24 A C 6: 123,764,266 (GRCm39) E381A probably damaging Het
Vmn2r95 G A 17: 18,661,721 (GRCm39) G489D probably benign Het
Wdr17 A T 8: 55,112,735 (GRCm39) F789I probably damaging Het
Xpnpep1 A T 19: 52,990,959 (GRCm39) L422Q probably damaging Het
Zfand3 T A 17: 30,372,302 (GRCm39) H107Q probably benign Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 104,057,455 (GRCm39) missense probably damaging 1.00
IGL01433:Ednrb APN 14 104,080,626 (GRCm39) missense probably damaging 0.98
IGL01631:Ednrb APN 14 104,080,661 (GRCm39) missense probably benign 0.02
IGL01696:Ednrb APN 14 104,060,625 (GRCm39) missense probably benign 0.00
IGL01974:Ednrb APN 14 104,058,254 (GRCm39) missense probably damaging 1.00
IGL02749:Ednrb APN 14 104,060,495 (GRCm39) missense possibly damaging 0.63
IGL03277:Ednrb APN 14 104,080,735 (GRCm39) missense probably benign 0.00
gus-gus UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
pongo UTSW 14 104,060,710 (GRCm39) splice site probably null
sposh UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R0284:Ednrb UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
R0591:Ednrb UTSW 14 104,060,710 (GRCm39) splice site probably null
R2072:Ednrb UTSW 14 104,054,535 (GRCm39) missense probably benign 0.27
R2080:Ednrb UTSW 14 104,080,536 (GRCm39) missense probably damaging 1.00
R2102:Ednrb UTSW 14 104,058,350 (GRCm39) nonsense probably null
R2118:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2119:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2124:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2851:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R2852:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R3708:Ednrb UTSW 14 104,054,516 (GRCm39) missense probably damaging 1.00
R4887:Ednrb UTSW 14 104,057,447 (GRCm39) missense possibly damaging 0.95
R5626:Ednrb UTSW 14 104,080,564 (GRCm39) missense probably damaging 0.98
R5688:Ednrb UTSW 14 104,060,831 (GRCm39) missense probably damaging 1.00
R5802:Ednrb UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R5834:Ednrb UTSW 14 104,058,313 (GRCm39) missense probably damaging 1.00
R7212:Ednrb UTSW 14 104,080,444 (GRCm39) missense probably damaging 0.96
R7368:Ednrb UTSW 14 104,057,453 (GRCm39) missense probably benign 0.01
R7766:Ednrb UTSW 14 104,080,725 (GRCm39) missense probably benign 0.12
R7866:Ednrb UTSW 14 104,080,738 (GRCm39) missense probably benign
R8170:Ednrb UTSW 14 104,060,640 (GRCm39) missense possibly damaging 0.92
R8220:Ednrb UTSW 14 104,059,141 (GRCm39) missense probably damaging 1.00
R8299:Ednrb UTSW 14 104,060,936 (GRCm39) missense probably damaging 1.00
R8375:Ednrb UTSW 14 104,057,383 (GRCm39) missense probably damaging 1.00
R8431:Ednrb UTSW 14 104,080,633 (GRCm39) missense probably benign 0.00
R9035:Ednrb UTSW 14 104,080,665 (GRCm39) missense probably benign 0.00
R9128:Ednrb UTSW 14 104,080,528 (GRCm39) missense probably damaging 1.00
R9547:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTATTGGCAGAGGAGCAGTCTC -3'
(R):5'- ACTCCAGTCTGATGCGTTCC -3'

Sequencing Primer
(F):5'- AGCAGTCTCCTTGAGAAAGTGTC -3'
(R):5'- TGCCAACGAAATATTGAGATCAGC -3'
Posted On 2022-07-18