Incidental Mutation 'R9547:Ly75'
ID 720157
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9547 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60292103-60383303 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 60330725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably null
Transcript: ENSMUST00000028362
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112533
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 C T 6: 88,838,935 V185M probably damaging Het
Acod1 A T 14: 103,054,858 S273C probably benign Het
Aifm3 T C 16: 17,499,740 V75A probably benign Het
Anks1 T C 17: 28,051,774 L845P probably damaging Het
Apc A G 18: 34,312,258 K736E possibly damaging Het
Atad2 A G 15: 58,126,577 S168P probably damaging Het
Cand2 G A 6: 115,782,796 A143T probably benign Het
Cep290 A T 10: 100,544,979 H116L probably benign Het
Chd9 G A 8: 90,956,558 R542H unknown Het
Crnkl1 T C 2: 145,930,630 M176V possibly damaging Het
Dnah14 A C 1: 181,593,427 probably null Het
Dync1h1 A G 12: 110,658,371 E3744G probably damaging Het
Ednrb T C 14: 103,843,023 I152V probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fat3 A T 9: 15,999,846 I1620N possibly damaging Het
Fbxo4 G A 15: 3,969,011 P322S probably damaging Het
Fbxw10 G T 11: 62,876,821 V828F possibly damaging Het
Gm7579 CTGTGTG CTGTG 7: 142,211,999 probably null Het
Gm8298 G T 3: 59,865,235 M53I probably benign Het
Gmip T C 8: 69,820,731 S891P possibly damaging Het
Grb10 A G 11: 11,943,919 I389T probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Hhatl A G 9: 121,789,583 Y118H probably damaging Het
Ighv1-69 A G 12: 115,623,265 F83L possibly damaging Het
Intu G A 3: 40,654,106 V183I probably benign Het
Ipo4 A G 14: 55,633,332 probably null Het
Kdm4c A C 4: 74,404,867 D1012A possibly damaging Het
Klrc2 C G 6: 129,656,849 A188P probably benign Het
Lipc T C 9: 70,820,864 D104G unknown Het
Lrrc63 A T 14: 75,107,388 L420M probably damaging Het
Mrpl50 T A 4: 49,514,338 H111L probably damaging Het
Mtmr9 A G 14: 63,542,406 I78T possibly damaging Het
Npepl1 A G 2: 174,120,237 D304G probably null Het
Nphs1 C T 7: 30,481,450 S1093F probably benign Het
Olfr136 G T 17: 38,335,450 V98F possibly damaging Het
Olfr195 T C 16: 59,149,744 I298T possibly damaging Het
Olfr938 G A 9: 39,078,631 T38I probably damaging Het
Pcdh18 A T 3: 49,755,057 I603K possibly damaging Het
Pdcd6ip A T 9: 113,655,106 Y818N unknown Het
Phf10 A G 17: 14,946,197 probably null Het
Phgdh A G 3: 98,334,634 S55P probably damaging Het
Poll G T 19: 45,557,920 P227H probably benign Het
Prdm2 A T 4: 143,134,991 S576R probably damaging Het
Psg26 T C 7: 18,480,162 I192V probably benign Het
Rpgrip1l T C 8: 91,251,245 D1038G probably benign Het
Snx18 A G 13: 113,617,218 M393T possibly damaging Het
Srsf11 A G 3: 158,012,098 C448R unknown Het
Sv2c A G 13: 96,048,500 I223T probably benign Het
Tbc1d1 T C 5: 64,173,607 V43A possibly damaging Het
Tex21 T C 12: 76,206,817 T441A probably damaging Het
Thnsl2 T A 6: 71,139,826 D114V probably damaging Het
Trpm2 A G 10: 77,912,633 V1401A probably benign Het
Ttll6 T C 11: 96,158,762 S769P probably benign Het
Uba5 A G 9: 104,054,368 S222P probably damaging Het
Ublcp1 T C 11: 44,456,424 Y290C probably damaging Het
Vmn1r216 A T 13: 23,099,285 D46V probably damaging Het
Wdr17 A T 8: 54,659,700 F789I probably damaging Het
Zcchc11 A G 4: 108,513,232 D776G probably benign Het
Zfp266 A G 9: 20,500,450 S144P probably benign Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 splice site probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
R7976:Ly75 UTSW 2 60365088 missense probably damaging 1.00
R8005:Ly75 UTSW 2 60332934 missense probably damaging 1.00
R8171:Ly75 UTSW 2 60314228 missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60349940 missense probably benign 0.00
R8705:Ly75 UTSW 2 60318385 missense probably damaging 0.98
R8714:Ly75 UTSW 2 60334485 missense probably damaging 1.00
R8798:Ly75 UTSW 2 60323926 missense probably benign 0.32
R8799:Ly75 UTSW 2 60348441 missense probably damaging 1.00
R8834:Ly75 UTSW 2 60331089 missense probably benign
R8990:Ly75 UTSW 2 60358559 missense probably benign 0.10
R9015:Ly75 UTSW 2 60316098 missense probably benign
R9628:Ly75 UTSW 2 60327941 missense probably damaging 1.00
R9659:Ly75 UTSW 2 60338321 missense probably damaging 1.00
R9660:Ly75 UTSW 2 60323840 missense probably damaging 1.00
R9747:Ly75 UTSW 2 60306328 critical splice donor site probably null
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60350004 nonsense probably null
Z1177:Ly75 UTSW 2 60352133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CAAACGTGTCTGTCTGCTTATC -3'
(R):5'- TTTGGGATCAAAGGAGTGGC -3'

Sequencing Primer
(F):5'- TGAGGGTAAAAGAACTGAACATATCC -3'
(R):5'- GCACTACAAGTTCTCACC -3'
Posted On 2022-07-18