Incidental Mutation 'R9547:Thnsl2'
ID 720171
Institutional Source Beutler Lab
Gene Symbol Thnsl2
Ensembl Gene ENSMUSG00000054474
Gene Name threonine synthase-like 2 (bacterial)
Synonyms TSH2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R9547 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 71128166-71144439 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71139826 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 114 (D114V)
Ref Sequence ENSEMBL: ENSMUSP00000124423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074241] [ENSMUST00000160918]
AlphaFold Q80W22
Predicted Effect probably damaging
Transcript: ENSMUST00000074241
AA Change: D114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073861
Gene: ENSMUSG00000054474
AA Change: D114V

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 2.4e-27 PFAM
Pfam:PALP 93 415 9.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160918
AA Change: D114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124423
Gene: ENSMUSG00000054474
AA Change: D114V

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 1.1e-27 PFAM
Pfam:PALP 94 413 8.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 C T 6: 88,838,935 V185M probably damaging Het
Acod1 A T 14: 103,054,858 S273C probably benign Het
Aifm3 T C 16: 17,499,740 V75A probably benign Het
Anks1 T C 17: 28,051,774 L845P probably damaging Het
Apc A G 18: 34,312,258 K736E possibly damaging Het
Atad2 A G 15: 58,126,577 S168P probably damaging Het
Cand2 G A 6: 115,782,796 A143T probably benign Het
Cep290 A T 10: 100,544,979 H116L probably benign Het
Chd9 G A 8: 90,956,558 R542H unknown Het
Crnkl1 T C 2: 145,930,630 M176V possibly damaging Het
Dnah14 A C 1: 181,593,427 probably null Het
Dync1h1 A G 12: 110,658,371 E3744G probably damaging Het
Ednrb T C 14: 103,843,023 I152V probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fat3 A T 9: 15,999,846 I1620N possibly damaging Het
Fbxo4 G A 15: 3,969,011 P322S probably damaging Het
Fbxw10 G T 11: 62,876,821 V828F possibly damaging Het
Gm7579 CTGTGTG CTGTG 7: 142,211,999 probably null Het
Gm8298 G T 3: 59,865,235 M53I probably benign Het
Gmip T C 8: 69,820,731 S891P possibly damaging Het
Grb10 A G 11: 11,943,919 I389T probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Hhatl A G 9: 121,789,583 Y118H probably damaging Het
Ighv1-69 A G 12: 115,623,265 F83L possibly damaging Het
Intu G A 3: 40,654,106 V183I probably benign Het
Ipo4 A G 14: 55,633,332 probably null Het
Kdm4c A C 4: 74,404,867 D1012A possibly damaging Het
Klrc2 C G 6: 129,656,849 A188P probably benign Het
Lipc T C 9: 70,820,864 D104G unknown Het
Lrrc63 A T 14: 75,107,388 L420M probably damaging Het
Ly75 C A 2: 60,330,725 probably null Het
Mrpl50 T A 4: 49,514,338 H111L probably damaging Het
Mtmr9 A G 14: 63,542,406 I78T possibly damaging Het
Npepl1 A G 2: 174,120,237 D304G probably null Het
Nphs1 C T 7: 30,481,450 S1093F probably benign Het
Olfr136 G T 17: 38,335,450 V98F possibly damaging Het
Olfr195 T C 16: 59,149,744 I298T possibly damaging Het
Olfr938 G A 9: 39,078,631 T38I probably damaging Het
Pcdh18 A T 3: 49,755,057 I603K possibly damaging Het
Pdcd6ip A T 9: 113,655,106 Y818N unknown Het
Phf10 A G 17: 14,946,197 probably null Het
Phgdh A G 3: 98,334,634 S55P probably damaging Het
Poll G T 19: 45,557,920 P227H probably benign Het
Prdm2 A T 4: 143,134,991 S576R probably damaging Het
Psg26 T C 7: 18,480,162 I192V probably benign Het
Rpgrip1l T C 8: 91,251,245 D1038G probably benign Het
Snx18 A G 13: 113,617,218 M393T possibly damaging Het
Srsf11 A G 3: 158,012,098 C448R unknown Het
Sv2c A G 13: 96,048,500 I223T probably benign Het
Tbc1d1 T C 5: 64,173,607 V43A possibly damaging Het
Tex21 T C 12: 76,206,817 T441A probably damaging Het
Trpm2 A G 10: 77,912,633 V1401A probably benign Het
Ttll6 T C 11: 96,158,762 S769P probably benign Het
Uba5 A G 9: 104,054,368 S222P probably damaging Het
Ublcp1 T C 11: 44,456,424 Y290C probably damaging Het
Vmn1r216 A T 13: 23,099,285 D46V probably damaging Het
Wdr17 A T 8: 54,659,700 F789I probably damaging Het
Zcchc11 A G 4: 108,513,232 D776G probably benign Het
Zfp266 A G 9: 20,500,450 S144P probably benign Het
Other mutations in Thnsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thnsl2 APN 6 71131900 missense probably damaging 1.00
IGL00814:Thnsl2 APN 6 71139883 missense probably damaging 1.00
IGL01139:Thnsl2 APN 6 71138734 missense probably damaging 1.00
IGL01380:Thnsl2 APN 6 71138756 missense probably benign
IGL01511:Thnsl2 APN 6 71139793 missense probably benign 0.04
IGL02000:Thnsl2 APN 6 71134219 missense probably damaging 1.00
IGL03157:Thnsl2 APN 6 71131946 missense probably benign 0.00
R0372:Thnsl2 UTSW 6 71139790 missense probably damaging 1.00
R0380:Thnsl2 UTSW 6 71141330 missense probably damaging 1.00
R0521:Thnsl2 UTSW 6 71134259 missense probably damaging 1.00
R0815:Thnsl2 UTSW 6 71134224 nonsense probably null
R0863:Thnsl2 UTSW 6 71134224 nonsense probably null
R1300:Thnsl2 UTSW 6 71134191 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R4767:Thnsl2 UTSW 6 71134295 missense probably damaging 1.00
R5578:Thnsl2 UTSW 6 71138765 missense probably benign 0.40
R5818:Thnsl2 UTSW 6 71134143 missense probably benign 0.01
R6627:Thnsl2 UTSW 6 71134215 missense possibly damaging 0.70
R6800:Thnsl2 UTSW 6 71141280 missense probably benign 0.29
R7192:Thnsl2 UTSW 6 71139755 missense probably benign 0.02
R7391:Thnsl2 UTSW 6 71131930 missense probably damaging 1.00
R7516:Thnsl2 UTSW 6 71132006 nonsense probably null
R7565:Thnsl2 UTSW 6 71141327 missense probably benign 0.00
R7980:Thnsl2 UTSW 6 71138668 missense probably damaging 1.00
R7988:Thnsl2 UTSW 6 71141319 missense probably benign 0.38
R8170:Thnsl2 UTSW 6 71129333 missense probably benign 0.05
R8917:Thnsl2 UTSW 6 71139943 missense probably benign
R9696:Thnsl2 UTSW 6 71131946 missense possibly damaging 0.95
X0021:Thnsl2 UTSW 6 71128704 missense probably benign 0.02
X0066:Thnsl2 UTSW 6 71139837 nonsense probably null
Z1177:Thnsl2 UTSW 6 71128841 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATAGCATAAGCCTTAAAAGATTCA -3'
(R):5'- TGCAATCCTGTTCCTAAGTGT -3'

Sequencing Primer
(F):5'- TCAATCAAGGGTATACCGTGC -3'
(R):5'- CTAGGCTTTTTAGTTGACAATGGGAG -3'
Posted On 2022-07-18