Incidental Mutation 'R9547:Nphs1'
ID 720176
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9547 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30157740-30186648 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30180875 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1093 (S1093F)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably benign
Transcript: ENSMUST00000006825
AA Change: S1093F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: S1093F

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126297
AA Change: S1079F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: S1079F

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000149086
AA Change: P61S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 G T 3: 59,772,656 (GRCm39) M53I probably benign Het
Abtb1 C T 6: 88,815,917 (GRCm39) V185M probably damaging Het
Acod1 A T 14: 103,292,294 (GRCm39) S273C probably benign Het
Aifm3 T C 16: 17,317,604 (GRCm39) V75A probably benign Het
Anks1 T C 17: 28,270,748 (GRCm39) L845P probably damaging Het
Apc A G 18: 34,445,311 (GRCm39) K736E possibly damaging Het
Atad2 A G 15: 57,989,973 (GRCm39) S168P probably damaging Het
Cand2 G A 6: 115,759,757 (GRCm39) A143T probably benign Het
Cep290 A T 10: 100,380,841 (GRCm39) H116L probably benign Het
Chd9 G A 8: 91,683,186 (GRCm39) R542H unknown Het
Crnkl1 T C 2: 145,772,550 (GRCm39) M176V possibly damaging Het
Dnah14 A C 1: 181,420,992 (GRCm39) probably null Het
Dync1h1 A G 12: 110,624,805 (GRCm39) E3744G probably damaging Het
Ednrb T C 14: 104,080,459 (GRCm39) I152V probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Fat3 A T 9: 15,911,142 (GRCm39) I1620N possibly damaging Het
Fbxo4 G A 15: 3,998,493 (GRCm39) P322S probably damaging Het
Fbxw10 G T 11: 62,767,647 (GRCm39) V828F possibly damaging Het
Gm7579 CTGTGTG CTGTG 7: 141,765,736 (GRCm39) probably null Het
Gmip T C 8: 70,273,381 (GRCm39) S891P possibly damaging Het
Grb10 A G 11: 11,893,919 (GRCm39) I389T probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Hhatl A G 9: 121,618,649 (GRCm39) Y118H probably damaging Het
Ighv1-69 A G 12: 115,586,885 (GRCm39) F83L possibly damaging Het
Intu G A 3: 40,608,536 (GRCm39) V183I probably benign Het
Ipo4 A G 14: 55,870,789 (GRCm39) probably null Het
Kdm4c A C 4: 74,323,104 (GRCm39) D1012A possibly damaging Het
Klrc2 C G 6: 129,633,812 (GRCm39) A188P probably benign Het
Lipc T C 9: 70,728,146 (GRCm39) D104G unknown Het
Lrrc63 A T 14: 75,344,828 (GRCm39) L420M probably damaging Het
Ly75 C A 2: 60,161,069 (GRCm39) probably null Het
Mrpl50 T A 4: 49,514,338 (GRCm39) H111L probably damaging Het
Mtmr9 A G 14: 63,779,855 (GRCm39) I78T possibly damaging Het
Npepl1 A G 2: 173,962,030 (GRCm39) D304G probably null Het
Or2n1d G T 17: 38,646,341 (GRCm39) V98F possibly damaging Het
Or5k3 T C 16: 58,970,107 (GRCm39) I298T possibly damaging Het
Or8g24 G A 9: 38,989,927 (GRCm39) T38I probably damaging Het
Pcdh18 A T 3: 49,709,506 (GRCm39) I603K possibly damaging Het
Pdcd6ip A T 9: 113,484,174 (GRCm39) Y818N unknown Het
Phf10 A G 17: 15,166,459 (GRCm39) probably null Het
Phgdh A G 3: 98,241,950 (GRCm39) S55P probably damaging Het
Poll G T 19: 45,546,359 (GRCm39) P227H probably benign Het
Prdm2 A T 4: 142,861,561 (GRCm39) S576R probably damaging Het
Psg26 T C 7: 18,214,087 (GRCm39) I192V probably benign Het
Rpgrip1l T C 8: 91,977,873 (GRCm39) D1038G probably benign Het
Snx18 A G 13: 113,753,754 (GRCm39) M393T possibly damaging Het
Srsf11 A G 3: 157,717,735 (GRCm39) C448R unknown Het
Sv2c A G 13: 96,185,008 (GRCm39) I223T probably benign Het
Tbc1d1 T C 5: 64,330,950 (GRCm39) V43A possibly damaging Het
Tex21 T C 12: 76,253,591 (GRCm39) T441A probably damaging Het
Thnsl2 T A 6: 71,116,810 (GRCm39) D114V probably damaging Het
Trpm2 A G 10: 77,748,467 (GRCm39) V1401A probably benign Het
Ttll6 T C 11: 96,049,588 (GRCm39) S769P probably benign Het
Tut4 A G 4: 108,370,429 (GRCm39) D776G probably benign Het
Uba5 A G 9: 103,931,567 (GRCm39) S222P probably damaging Het
Ublcp1 T C 11: 44,347,251 (GRCm39) Y290C probably damaging Het
Vmn1r216 A T 13: 23,283,455 (GRCm39) D46V probably damaging Het
Wdr17 A T 8: 55,112,735 (GRCm39) F789I probably damaging Het
Zfp266 A G 9: 20,411,746 (GRCm39) S144P probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30,181,976 (GRCm39) missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30,160,164 (GRCm39) unclassified probably benign
IGL00976:Nphs1 APN 7 30,160,110 (GRCm39) missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30,186,089 (GRCm39) missense probably benign 0.01
IGL01465:Nphs1 APN 7 30,186,139 (GRCm39) makesense probably null
IGL01889:Nphs1 APN 7 30,159,936 (GRCm39) missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30,181,060 (GRCm39) splice site probably benign
R0020:Nphs1 UTSW 7 30,162,633 (GRCm39) missense probably benign 0.01
R0485:Nphs1 UTSW 7 30,166,940 (GRCm39) missense probably benign
R1024:Nphs1 UTSW 7 30,173,702 (GRCm39) missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30,180,803 (GRCm39) splice site probably benign
R1144:Nphs1 UTSW 7 30,181,103 (GRCm39) splice site probably benign
R1289:Nphs1 UTSW 7 30,170,603 (GRCm39) missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30,181,256 (GRCm39) splice site probably benign
R1617:Nphs1 UTSW 7 30,181,956 (GRCm39) missense probably benign
R1756:Nphs1 UTSW 7 30,160,959 (GRCm39) missense probably benign 0.00
R1937:Nphs1 UTSW 7 30,173,798 (GRCm39) missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30,160,395 (GRCm39) missense probably benign 0.13
R2256:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30,166,989 (GRCm39) nonsense probably null
R3104:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3106:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3151:Nphs1 UTSW 7 30,159,665 (GRCm39) missense probably benign
R3765:Nphs1 UTSW 7 30,170,635 (GRCm39) missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30,166,945 (GRCm39) nonsense probably null
R4397:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R4635:Nphs1 UTSW 7 30,167,432 (GRCm39) missense probably benign 0.39
R4650:Nphs1 UTSW 7 30,181,895 (GRCm39) missense probably benign 0.21
R4811:Nphs1 UTSW 7 30,159,854 (GRCm39) missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30,162,657 (GRCm39) missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30,181,067 (GRCm39) missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30,163,250 (GRCm39) missense probably benign 0.00
R5681:Nphs1 UTSW 7 30,186,050 (GRCm39) missense probably benign 0.00
R5865:Nphs1 UTSW 7 30,173,810 (GRCm39) missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30,165,540 (GRCm39) missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30,165,059 (GRCm39) missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30,167,340 (GRCm39) missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30,173,969 (GRCm39) missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30,162,253 (GRCm39) missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R7767:Nphs1 UTSW 7 30,162,733 (GRCm39) missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30,181,478 (GRCm39) missense probably benign 0.02
R8485:Nphs1 UTSW 7 30,165,598 (GRCm39) missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30,163,284 (GRCm39) missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30,162,080 (GRCm39) missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30,162,625 (GRCm39) missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30,160,092 (GRCm39) nonsense probably null
R9159:Nphs1 UTSW 7 30,165,026 (GRCm39) missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30,170,594 (GRCm39) missense probably damaging 1.00
R9548:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9607:Nphs1 UTSW 7 30,163,012 (GRCm39) missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30,166,991 (GRCm39) missense probably benign 0.16
R9720:Nphs1 UTSW 7 30,165,499 (GRCm39) missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30,166,955 (GRCm39) missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30,166,929 (GRCm39) missense probably null 0.01
Z1177:Nphs1 UTSW 7 30,170,328 (GRCm39) missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30,159,775 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCACAAGTGTCCTAGG -3'
(R):5'- CTGAGATCTCTGGGAGAAACG -3'

Sequencing Primer
(F):5'- CACAAGTGTCCTAGGCGATTTG -3'
(R):5'- CAGCTTGGCACTGAGAAA -3'
Posted On 2022-07-18