Incidental Mutation 'R9547:Nphs1'
ID 720176
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9547 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30481450 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1093 (S1093F)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably benign
Transcript: ENSMUST00000006825
AA Change: S1093F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: S1093F

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126297
AA Change: S1079F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: S1079F

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000149086
AA Change: P61S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 C T 6: 88,838,935 V185M probably damaging Het
Acod1 A T 14: 103,054,858 S273C probably benign Het
Aifm3 T C 16: 17,499,740 V75A probably benign Het
Anks1 T C 17: 28,051,774 L845P probably damaging Het
Apc A G 18: 34,312,258 K736E possibly damaging Het
Atad2 A G 15: 58,126,577 S168P probably damaging Het
Cand2 G A 6: 115,782,796 A143T probably benign Het
Cep290 A T 10: 100,544,979 H116L probably benign Het
Chd9 G A 8: 90,956,558 R542H unknown Het
Crnkl1 T C 2: 145,930,630 M176V possibly damaging Het
Dnah14 A C 1: 181,593,427 probably null Het
Dync1h1 A G 12: 110,658,371 E3744G probably damaging Het
Ednrb T C 14: 103,843,023 I152V probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fat3 A T 9: 15,999,846 I1620N possibly damaging Het
Fbxo4 G A 15: 3,969,011 P322S probably damaging Het
Fbxw10 G T 11: 62,876,821 V828F possibly damaging Het
Gm7579 CTGTGTG CTGTG 7: 142,211,999 probably null Het
Gm8298 G T 3: 59,865,235 M53I probably benign Het
Gmip T C 8: 69,820,731 S891P possibly damaging Het
Grb10 A G 11: 11,943,919 I389T probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Hhatl A G 9: 121,789,583 Y118H probably damaging Het
Ighv1-69 A G 12: 115,623,265 F83L possibly damaging Het
Intu G A 3: 40,654,106 V183I probably benign Het
Ipo4 A G 14: 55,633,332 probably null Het
Kdm4c A C 4: 74,404,867 D1012A possibly damaging Het
Klrc2 C G 6: 129,656,849 A188P probably benign Het
Lipc T C 9: 70,820,864 D104G unknown Het
Lrrc63 A T 14: 75,107,388 L420M probably damaging Het
Ly75 C A 2: 60,330,725 probably null Het
Mrpl50 T A 4: 49,514,338 H111L probably damaging Het
Mtmr9 A G 14: 63,542,406 I78T possibly damaging Het
Npepl1 A G 2: 174,120,237 D304G probably null Het
Olfr136 G T 17: 38,335,450 V98F possibly damaging Het
Olfr195 T C 16: 59,149,744 I298T possibly damaging Het
Olfr938 G A 9: 39,078,631 T38I probably damaging Het
Pcdh18 A T 3: 49,755,057 I603K possibly damaging Het
Pdcd6ip A T 9: 113,655,106 Y818N unknown Het
Phf10 A G 17: 14,946,197 probably null Het
Phgdh A G 3: 98,334,634 S55P probably damaging Het
Poll G T 19: 45,557,920 P227H probably benign Het
Prdm2 A T 4: 143,134,991 S576R probably damaging Het
Psg26 T C 7: 18,480,162 I192V probably benign Het
Rpgrip1l T C 8: 91,251,245 D1038G probably benign Het
Snx18 A G 13: 113,617,218 M393T possibly damaging Het
Srsf11 A G 3: 158,012,098 C448R unknown Het
Sv2c A G 13: 96,048,500 I223T probably benign Het
Tbc1d1 T C 5: 64,173,607 V43A possibly damaging Het
Tex21 T C 12: 76,206,817 T441A probably damaging Het
Thnsl2 T A 6: 71,139,826 D114V probably damaging Het
Trpm2 A G 10: 77,912,633 V1401A probably benign Het
Ttll6 T C 11: 96,158,762 S769P probably benign Het
Uba5 A G 9: 104,054,368 S222P probably damaging Het
Ublcp1 T C 11: 44,456,424 Y290C probably damaging Het
Vmn1r216 A T 13: 23,099,285 D46V probably damaging Het
Wdr17 A T 8: 54,659,700 F789I probably damaging Het
Zcchc11 A G 4: 108,513,232 D776G probably benign Het
Zfp266 A G 9: 20,500,450 S144P probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCACAAGTGTCCTAGG -3'
(R):5'- CTGAGATCTCTGGGAGAAACG -3'

Sequencing Primer
(F):5'- CACAAGTGTCCTAGGCGATTTG -3'
(R):5'- CAGCTTGGCACTGAGAAA -3'
Posted On 2022-07-18