Incidental Mutation 'R9547:Olfr938'
ID 720184
Institutional Source Beutler Lab
Gene Symbol Olfr938
Ensembl Gene ENSMUSG00000048501
Gene Name olfactory receptor 938
Synonyms GA_x6K02T2PVTD-32774646-32773699, MOR171-25
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R9547 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 39077698-39078887 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 39078631 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 38 (T38I)
Ref Sequence ENSEMBL: ENSMUSP00000055053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056499]
AlphaFold Q9EQ93
Predicted Effect probably damaging
Transcript: ENSMUST00000056499
AA Change: T38I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055053
Gene: ENSMUSG00000048501
AA Change: T38I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-49 PFAM
Pfam:7tm_1 41 290 5.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 C T 6: 88,838,935 V185M probably damaging Het
Acod1 A T 14: 103,054,858 S273C probably benign Het
Aifm3 T C 16: 17,499,740 V75A probably benign Het
Anks1 T C 17: 28,051,774 L845P probably damaging Het
Apc A G 18: 34,312,258 K736E possibly damaging Het
Atad2 A G 15: 58,126,577 S168P probably damaging Het
Cand2 G A 6: 115,782,796 A143T probably benign Het
Cep290 A T 10: 100,544,979 H116L probably benign Het
Chd9 G A 8: 90,956,558 R542H unknown Het
Crnkl1 T C 2: 145,930,630 M176V possibly damaging Het
Dnah14 A C 1: 181,593,427 probably null Het
Dync1h1 A G 12: 110,658,371 E3744G probably damaging Het
Ednrb T C 14: 103,843,023 I152V probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fat3 A T 9: 15,999,846 I1620N possibly damaging Het
Fbxo4 G A 15: 3,969,011 P322S probably damaging Het
Fbxw10 G T 11: 62,876,821 V828F possibly damaging Het
Gm7579 CTGTGTG CTGTG 7: 142,211,999 probably null Het
Gm8298 G T 3: 59,865,235 M53I probably benign Het
Gmip T C 8: 69,820,731 S891P possibly damaging Het
Grb10 A G 11: 11,943,919 I389T probably benign Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Hhatl A G 9: 121,789,583 Y118H probably damaging Het
Ighv1-69 A G 12: 115,623,265 F83L possibly damaging Het
Intu G A 3: 40,654,106 V183I probably benign Het
Ipo4 A G 14: 55,633,332 probably null Het
Kdm4c A C 4: 74,404,867 D1012A possibly damaging Het
Klrc2 C G 6: 129,656,849 A188P probably benign Het
Lipc T C 9: 70,820,864 D104G unknown Het
Lrrc63 A T 14: 75,107,388 L420M probably damaging Het
Ly75 C A 2: 60,330,725 probably null Het
Mrpl50 T A 4: 49,514,338 H111L probably damaging Het
Mtmr9 A G 14: 63,542,406 I78T possibly damaging Het
Npepl1 A G 2: 174,120,237 D304G probably null Het
Nphs1 C T 7: 30,481,450 S1093F probably benign Het
Olfr136 G T 17: 38,335,450 V98F possibly damaging Het
Olfr195 T C 16: 59,149,744 I298T possibly damaging Het
Pcdh18 A T 3: 49,755,057 I603K possibly damaging Het
Pdcd6ip A T 9: 113,655,106 Y818N unknown Het
Phf10 A G 17: 14,946,197 probably null Het
Phgdh A G 3: 98,334,634 S55P probably damaging Het
Poll G T 19: 45,557,920 P227H probably benign Het
Prdm2 A T 4: 143,134,991 S576R probably damaging Het
Psg26 T C 7: 18,480,162 I192V probably benign Het
Rpgrip1l T C 8: 91,251,245 D1038G probably benign Het
Snx18 A G 13: 113,617,218 M393T possibly damaging Het
Srsf11 A G 3: 158,012,098 C448R unknown Het
Sv2c A G 13: 96,048,500 I223T probably benign Het
Tbc1d1 T C 5: 64,173,607 V43A possibly damaging Het
Tex21 T C 12: 76,206,817 T441A probably damaging Het
Thnsl2 T A 6: 71,139,826 D114V probably damaging Het
Trpm2 A G 10: 77,912,633 V1401A probably benign Het
Ttll6 T C 11: 96,158,762 S769P probably benign Het
Uba5 A G 9: 104,054,368 S222P probably damaging Het
Ublcp1 T C 11: 44,456,424 Y290C probably damaging Het
Vmn1r216 A T 13: 23,099,285 D46V probably damaging Het
Wdr17 A T 8: 54,659,700 F789I probably damaging Het
Zcchc11 A G 4: 108,513,232 D776G probably benign Het
Zfp266 A G 9: 20,500,450 S144P probably benign Het
Other mutations in Olfr938
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr938 APN 9 39078451 missense probably damaging 0.96
IGL01298:Olfr938 APN 9 39078724 missense possibly damaging 0.63
IGL02930:Olfr938 APN 9 39078012 missense probably damaging 1.00
IGL03346:Olfr938 APN 9 39077962 missense probably damaging 0.99
IGL03346:Olfr938 APN 9 39077961 missense probably benign 0.35
IGL03399:Olfr938 APN 9 39078237 nonsense probably null
R0536:Olfr938 UTSW 9 39078329 missense probably benign 0.03
R1170:Olfr938 UTSW 9 39078229 missense possibly damaging 0.50
R1951:Olfr938 UTSW 9 39078284 missense probably benign 0.07
R1952:Olfr938 UTSW 9 39078284 missense probably benign 0.07
R2066:Olfr938 UTSW 9 39078214 missense probably damaging 1.00
R2906:Olfr938 UTSW 9 39078373 missense probably benign 0.39
R4707:Olfr938 UTSW 9 39078262 missense probably benign 0.00
R4767:Olfr938 UTSW 9 39078692 missense possibly damaging 0.71
R4951:Olfr938 UTSW 9 39078259 missense probably benign 0.10
R5888:Olfr938 UTSW 9 39077967 nonsense probably null
R5905:Olfr938 UTSW 9 39078083 missense probably damaging 1.00
R6028:Olfr938 UTSW 9 39078083 missense probably damaging 1.00
R6329:Olfr938 UTSW 9 39077903 missense probably benign 0.02
R7240:Olfr938 UTSW 9 39078610 missense probably damaging 0.99
R7345:Olfr938 UTSW 9 39078334 missense probably damaging 1.00
R8058:Olfr938 UTSW 9 39078566 missense probably damaging 1.00
R9023:Olfr938 UTSW 9 39078011 missense probably benign 0.09
X0062:Olfr938 UTSW 9 39078466 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACTGAGCTATGCATTGTGGG -3'
(R):5'- ATGGCTACGGACCTCTTGTG -3'

Sequencing Primer
(F):5'- ACTGAGCTATGCATTGTGGGTATGAG -3'
(R):5'- CCTCACTGGGTTAACAGA -3'
Posted On 2022-07-18