Incidental Mutation 'R9548:Nphs1'
ID 720238
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9548 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30481450 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 1093 (S1093F)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably benign
Transcript: ENSMUST00000006825
AA Change: S1093F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: S1093F

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126297
AA Change: S1079F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: S1079F

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000149086
AA Change: P61S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik G A 5: 9,440,859 G623D probably damaging Het
AF067063 T A 13: 119,828,388 I91F probably benign Het
Ankfy1 G A 11: 72,750,179 probably null Het
Arid1b A G 17: 5,334,987 Y1340C probably damaging Het
Bcl2 C A 1: 106,712,778 A35S probably benign Het
Brf2 A T 8: 27,124,595 S188T probably benign Het
Carmil1 C A 13: 24,276,533 G21V probably damaging Het
Cavin4 T C 4: 48,663,956 V112A probably benign Het
Cd300lf T C 11: 115,117,032 E319G probably benign Het
Cd44 A T 2: 102,831,487 D587E possibly damaging Het
Cfap53 A T 18: 74,304,969 T239S possibly damaging Het
Cma2 A C 14: 55,973,799 I239L probably damaging Het
Cnot1 A T 8: 95,756,226 M733K probably benign Het
Cyp2f2 A G 7: 27,129,745 D225G probably benign Het
Cyp4f40 G A 17: 32,671,184 R276H probably benign Het
Cytip A T 2: 58,151,129 F88L probably damaging Het
Dnaaf2 T C 12: 69,198,002 N95S probably damaging Het
Dnah5 C A 15: 28,327,879 T2133K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epn2 A T 11: 61,546,162 S195T probably benign Het
Exoc3 A T 13: 74,182,166 Y521N possibly damaging Het
Fbxo10 C A 4: 45,058,970 V256L probably damaging Het
Fis1 A T 5: 136,963,053 T34S probably benign Het
Gm10309 A T 17: 86,498,733 C118S unknown Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Hook1 T A 4: 96,003,571 V340E probably damaging Het
Ifng C A 10: 118,441,223 H23Q probably benign Het
Lect2 C T 13: 56,546,847 E32K probably benign Het
Lrp1 T G 10: 127,552,864 T3239P probably damaging Het
Lrrc14b T A 13: 74,363,877 Y28F probably benign Het
Maml3 A T 3: 51,856,370 V391E possibly damaging Het
Map3k8 C T 18: 4,349,141 R59H probably benign Het
Med1 G T 11: 98,180,058 L120I possibly damaging Het
Muc5b C A 7: 141,867,911 H4349N possibly damaging Het
Myo1h C T 5: 114,361,093 P110S probably benign Het
Nol10 T G 12: 17,416,143 I513S possibly damaging Het
Olfr1145 A T 2: 87,810,753 N311I probably damaging Het
Olfr1151 A T 2: 87,857,696 I174F probably damaging Het
Olfr1272 T C 2: 90,281,647 *309W probably null Het
Olfr497 A T 7: 108,423,209 T213S possibly damaging Het
Olfr504 A T 7: 108,565,127 S223T possibly damaging Het
Pcdh17 A T 14: 84,447,962 Y623F possibly damaging Het
Pdzd8 T A 19: 59,301,394 I525F probably benign Het
Peak1 G T 9: 56,206,633 Q1675K probably benign Het
Perm1 T C 4: 156,217,833 V278A probably benign Het
Ppp2r5d G A 17: 46,687,601 R115C probably damaging Het
Rnf169 A T 7: 99,925,483 L635Q probably damaging Het
Sacs A G 14: 61,203,243 T913A probably benign Het
Sh3bp1 A T 15: 78,904,473 I233F possibly damaging Het
Skint9 T G 4: 112,419,149 L8F probably benign Het
Slc1a4 A T 11: 20,308,041 N360K probably damaging Het
Slc22a16 T A 10: 40,584,869 Y243* probably null Het
Slc22a19 C A 19: 7,681,854 probably null Het
Smarcal1 T C 1: 72,632,840 I840T possibly damaging Het
Spata13 A G 14: 60,753,854 K1019E possibly damaging Het
Steap1 A G 5: 5,740,700 S83P possibly damaging Het
Synj2bp T C 12: 81,504,608 H78R probably damaging Het
Tjp3 T C 10: 81,277,999 E475G probably damaging Het
Top3a A G 11: 60,753,942 V312A probably benign Het
Traip C A 9: 107,955,900 T45N probably damaging Het
Ttn T C 2: 76,743,347 Y25734C probably damaging Het
Unc79 T A 12: 103,011,236 V166D probably damaging Het
Urgcp C A 11: 5,717,622 V282F possibly damaging Het
Vmn1r184 G A 7: 26,267,309 S160N probably benign Het
Wdfy3 T C 5: 101,885,193 D2231G probably damaging Het
Zan C T 5: 137,403,061 G4132D unknown Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTGTCCTAGGCGATTTGG -3'
(R):5'- TCTGAGATCTCTGGGAGAAACGAG -3'

Sequencing Primer
(F):5'- CGTCAGGTTGGCACTGAAGAC -3'
(R):5'- CAGCTTGGCACTGAGAAA -3'
Posted On 2022-07-18