Incidental Mutation 'R9113:Glg1'
ID 720344
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Name golgi apparatus protein 1
Synonyms Selel, CFR, MG-160, CFR-1, ESL-1, MG160
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R9113 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 111154421-111259216 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to T at 111160820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000168741] [ENSMUST00000169020]
AlphaFold Q61543
Predicted Effect probably benign
Transcript: ENSMUST00000003404
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164283
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168741
SMART Domains Protein: ENSMUSP00000130327
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
Pfam:Cys_rich_FGFR 1 57 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 58 118 8.5e-15 PFAM
Pfam:Cys_rich_FGFR 121 177 2e-14 PFAM
Pfam:Cys_rich_FGFR 188 245 4.3e-19 PFAM
Pfam:Cys_rich_FGFR 246 301 1.8e-17 PFAM
Pfam:Cys_rich_FGFR 304 368 8.9e-22 PFAM
Pfam:Cys_rich_FGFR 371 431 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 459 513 1.6e-15 PFAM
transmembrane domain 558 580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169020
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,295,518 Q553* probably null Het
Abcc9 T A 6: 142,645,930 I791F probably damaging Het
Adamts15 A G 9: 30,911,202 M389T probably damaging Het
Adgrb2 G A 4: 130,017,084 V1065M probably damaging Het
Agbl1 C A 7: 76,589,477 A827E unknown Het
Alox5ap T C 5: 149,279,205 F67S probably damaging Het
Ankrd11 T C 8: 122,887,333 N2566S possibly damaging Het
Arhgap10 T C 8: 77,259,072 D722G probably damaging Het
Atp5j2 A G 5: 145,191,505 L4P probably benign Het
Bean1 T C 8: 104,213,925 V130A probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdhr2 A G 13: 54,734,887 D1222G probably benign Het
Chrm4 T A 2: 91,927,730 V161E probably benign Het
Ckap5 T C 2: 91,595,799 S1335P probably damaging Het
Col11a1 T A 3: 114,094,543 Y267* probably null Het
Col14a1 T C 15: 55,338,429 Y38H unknown Het
Coro2a C T 4: 46,563,047 G36S Het
Ctsc A T 7: 88,309,896 K461N possibly damaging Het
Dcaf1 A G 9: 106,835,632 probably benign Het
Dnah9 A G 11: 65,989,887 I2628T probably damaging Het
Dnajb5 T C 4: 42,953,233 I20T probably damaging Het
Dus2 C T 8: 106,048,701 Q287* probably null Het
Fbxl17 A G 17: 63,225,090 V586A probably benign Het
Gm10639 A T 9: 78,305,385 I213F probably benign Het
Gm4924 G A 10: 82,378,279 C637Y unknown Het
Gorasp1 A G 9: 119,928,376 F310S probably damaging Het
Igfn1 G A 1: 135,955,590 T2726I probably damaging Het
Inppl1 G T 7: 101,826,024 P940Q probably benign Het
Klk1b22 G A 7: 44,116,268 V183M possibly damaging Het
Krt12 A G 11: 99,418,552 M294T probably damaging Het
Krtap6-2 GAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCGTATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAACCATAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCA GAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCGTATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAACCATAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCA 16: 89,419,725 probably benign Het
Lep T C 6: 29,071,094 L139P probably damaging Het
Ltn1 T C 16: 87,427,644 D64G probably damaging Het
Lyzl1 C T 18: 4,168,604 A28V probably null Het
Mcam T C 9: 44,140,396 V483A probably benign Het
Mia2 C T 12: 59,170,267 probably benign Het
Mzf1 T A 7: 13,044,352 H454L probably damaging Het
Pde10a A G 17: 8,978,950 T742A probably benign Het
Rapgef4 A G 2: 72,031,149 Y61C probably benign Het
Ryr2 A T 13: 11,603,855 probably benign Het
Setbp1 G T 18: 78,857,733 H906Q probably damaging Het
Slc12a4 A G 8: 105,944,352 V1032A probably benign Het
Slc6a15 T C 10: 103,400,279 M285T probably damaging Het
Steap2 A G 5: 5,677,475 Y287H probably damaging Het
Tas2r135 T G 6: 42,406,381 F285V probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Ttn T C 2: 76,788,194 T16249A probably benign Het
Usp8 A G 2: 126,737,423 T299A probably benign Het
Vmn2r101 A G 17: 19,591,026 I457M possibly damaging Het
Vps41 A G 13: 18,839,713 E437G probably benign Het
Zfp638 A T 6: 83,976,912 E1333V probably damaging Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111159849 missense probably damaging 1.00
IGL01326:Glg1 APN 8 111182573 missense probably damaging 0.96
IGL01558:Glg1 APN 8 111187730 missense probably benign 0.00
IGL01798:Glg1 APN 8 111192700 missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111160727 missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111200171 missense probably damaging 1.00
IGL03374:Glg1 APN 8 111162780 missense probably damaging 1.00
IGL03404:Glg1 APN 8 111159902 missense probably damaging 1.00
diabolical UTSW 8 111168743 missense probably damaging 1.00
BB007:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
BB017:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
PIT4362001:Glg1 UTSW 8 111258799 missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0255:Glg1 UTSW 8 111159858 missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111182569 missense probably damaging 1.00
R0458:Glg1 UTSW 8 111160606 splice site probably benign
R0635:Glg1 UTSW 8 111163764 splice site probably benign
R0765:Glg1 UTSW 8 111159797 critical splice donor site probably null
R1104:Glg1 UTSW 8 111197603 missense probably benign 0.01
R1495:Glg1 UTSW 8 111197675 missense probably damaging 1.00
R1747:Glg1 UTSW 8 111197673 missense probably damaging 1.00
R1899:Glg1 UTSW 8 111165674 missense probably benign 0.23
R1950:Glg1 UTSW 8 111165639 missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111168671 missense probably damaging 1.00
R2112:Glg1 UTSW 8 111192546 missense probably damaging 1.00
R2275:Glg1 UTSW 8 111168721 nonsense probably null
R2342:Glg1 UTSW 8 111187807 nonsense probably null
R4633:Glg1 UTSW 8 111177644 critical splice donor site probably null
R4716:Glg1 UTSW 8 111160775 nonsense probably null
R4732:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R4733:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R5594:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R5722:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R5951:Glg1 UTSW 8 111165691 missense possibly damaging 0.64
R5958:Glg1 UTSW 8 111259104 missense probably benign 0.01
R6090:Glg1 UTSW 8 111181035 missense probably damaging 1.00
R6476:Glg1 UTSW 8 111200174 missense possibly damaging 0.94
R6480:Glg1 UTSW 8 111197706 missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R7116:Glg1 UTSW 8 111178957 missense probably benign 0.22
R7293:Glg1 UTSW 8 111168743 missense probably damaging 1.00
R7431:Glg1 UTSW 8 111160754 missense unknown
R7479:Glg1 UTSW 8 111197735 missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111259043 missense probably benign 0.04
R7547:Glg1 UTSW 8 111187761 missense possibly damaging 0.89
R7678:Glg1 UTSW 8 111178865 missense probably benign 0.19
R7930:Glg1 UTSW 8 111160735 missense possibly damaging 0.46
R8182:Glg1 UTSW 8 111171297 missense possibly damaging 0.88
R8383:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R8787:Glg1 UTSW 8 111161482 missense probably damaging 0.99
R8905:Glg1 UTSW 8 111158036 missense probably damaging 0.99
R8954:Glg1 UTSW 8 111187895 missense probably damaging 1.00
R8958:Glg1 UTSW 8 111172484 nonsense probably null
R9023:Glg1 UTSW 8 111177748 missense probably damaging 0.99
R9359:Glg1 UTSW 8 111187793 missense probably benign 0.08
R9403:Glg1 UTSW 8 111187793 missense probably benign 0.08
R9553:Glg1 UTSW 8 111200138 missense probably benign 0.04
R9622:Glg1 UTSW 8 111172501 missense probably damaging 1.00
R9714:Glg1 UTSW 8 111197669 missense probably damaging 1.00
X0027:Glg1 UTSW 8 111169600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAGACTGGACAAACATTAC -3'
(R):5'- CCAAGAACCCTGCCTGATGATC -3'

Sequencing Primer
(F):5'- TGGACAAACATTACTCACGACG -3'
(R):5'- GAACCCTGCCTGATGATCCAGTC -3'
Posted On 2022-07-20