Incidental Mutation 'R9032:Rpap1'
ID 720352
Institutional Source Beutler Lab
Gene Symbol Rpap1
Ensembl Gene ENSMUSG00000034032
Gene Name RNA polymerase II associated protein 1
Synonyms A730023M06Rik, 1190005L06Rik
MMRRC Submission 068861-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R9032 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 119594440-119618018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119608776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 143 (P143S)
Ref Sequence ENSEMBL: ENSMUSP00000138619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048493] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000184294]
AlphaFold Q80TE0
Predicted Effect silent
Transcript: ENSMUST00000048493
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000099529
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000110793
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136419
AA Change: P143S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032
AA Change: P143S

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000184294
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein forms part of the RNA polymerase II (RNAPII) enzyme complex and may recruit RNAPII to chromatin through its interaction with acetylated histones. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,844,782 (GRCm39) M78I probably benign Het
Abca8b C T 11: 109,848,073 (GRCm39) V803M probably benign Het
Acap1 T C 11: 69,772,491 (GRCm39) E728G probably damaging Het
Afg1l G A 10: 42,194,637 (GRCm39) T385M probably damaging Het
Ankib1 T C 5: 3,819,641 (GRCm39) I93V probably benign Het
Aopep C T 13: 63,444,681 (GRCm39) R752* probably null Het
Apoa4 T A 9: 46,154,275 (GRCm39) L292Q probably damaging Het
Arhgap29 T A 3: 121,808,249 (GRCm39) D1142E probably benign Het
Asb5 A T 8: 55,038,929 (GRCm39) D265V probably benign Het
Ash1l C T 3: 88,889,294 (GRCm39) A391V probably benign Het
Ash1l T C 3: 88,891,529 (GRCm39) V1136A probably benign Het
Cacna1c G T 6: 118,615,466 (GRCm39) Y1308* probably null Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,604,874 (GRCm39) probably benign Het
Dmtn A G 14: 70,853,534 (GRCm39) S92P probably damaging Het
Edc4 T C 8: 106,613,639 (GRCm39) F353S probably damaging Het
Emc1 T C 4: 139,094,474 (GRCm39) Y676H possibly damaging Het
Epb41l4b A T 4: 57,041,064 (GRCm39) probably null Het
Fat1 A T 8: 45,492,894 (GRCm39) N3872I probably benign Het
Fer T A 17: 64,228,767 (GRCm39) M214K probably damaging Het
Fgf17 A G 14: 70,874,436 (GRCm39) F129L probably damaging Het
Fnbp1 T C 2: 30,973,017 (GRCm39) D161G probably damaging Het
Frmd4b A C 6: 97,269,334 (GRCm39) S993A probably benign Het
Hsh2d T C 8: 72,954,385 (GRCm39) S256P probably benign Het
Il31ra T C 13: 112,660,628 (GRCm39) S654G Het
Lmnb2 T C 10: 80,740,091 (GRCm39) D442G probably benign Het
Med19 A G 2: 84,515,660 (GRCm39) M115V probably damaging Het
Mroh5 T C 15: 73,655,302 (GRCm39) Y641C probably benign Het
Mrpl18 A T 17: 13,134,582 (GRCm39) V61E probably damaging Het
Mrtfb A C 16: 13,230,092 (GRCm39) T926P probably damaging Het
Mtap AC A 4: 89,090,515 (GRCm39) probably null Het
Muc2 T A 7: 141,287,058 (GRCm39) C154S probably damaging Het
Mypn T G 10: 62,983,894 (GRCm39) probably null Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nes T G 3: 87,887,069 (GRCm39) V1776G possibly damaging Het
Nxn A G 11: 76,169,383 (GRCm39) I132T probably damaging Het
Oxr1 G A 15: 41,718,317 (GRCm39) V798I probably benign Het
Papss1 C A 3: 131,324,817 (GRCm39) H425N probably damaging Het
Pde4dip T C 3: 97,601,385 (GRCm39) N2344S probably benign Het
Pfas C T 11: 68,879,421 (GRCm39) G263S Het
Pknox1 C T 17: 31,822,229 (GRCm39) T332M possibly damaging Het
Plch2 T C 4: 155,084,976 (GRCm39) D321G probably damaging Het
Pnma1 T C 12: 84,193,806 (GRCm39) N299S probably benign Het
Psg23 T G 7: 18,348,660 (GRCm39) N49T possibly damaging Het
Qrfpr A G 3: 36,276,099 (GRCm39) F97S probably damaging Het
Rbl1 A G 2: 157,035,073 (GRCm39) F336L probably benign Het
Rsph6a A T 7: 18,799,250 (GRCm39) N294Y probably damaging Het
Serpinb9h T C 13: 33,581,781 (GRCm39) Y113H probably damaging Het
Sesn1 C T 10: 41,686,835 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,033,992 (GRCm39) Y782H probably damaging Het
Siglecg T C 7: 43,061,049 (GRCm39) V374A probably benign Het
Slc35d2 A G 13: 64,256,227 (GRCm39) F156S probably damaging Het
Slc6a11 A T 6: 114,202,808 (GRCm39) I301F probably damaging Het
Slx4ip A G 2: 136,910,240 (GRCm39) K412E possibly damaging Het
Tas2r115 A T 6: 132,714,327 (GRCm39) V208E probably benign Het
Tlcd5 C T 9: 43,022,664 (GRCm39) R230Q probably benign Het
Tmem132a G T 19: 10,843,835 (GRCm39) Q174K probably damaging Het
Tmtc1 A T 6: 148,237,749 (GRCm39) Y338* probably null Het
Vav3 C T 3: 109,413,722 (GRCm39) A220V probably benign Het
Wt1 C A 2: 104,957,160 (GRCm39) Q7K probably benign Het
Zbtb4 T A 11: 69,672,650 (GRCm39) F204L probably benign Het
Zfp51 T A 17: 21,684,660 (GRCm39) L425H probably damaging Het
Other mutations in Rpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Rpap1 APN 2 119,613,189 (GRCm39) missense possibly damaging 0.50
IGL02009:Rpap1 APN 2 119,610,594 (GRCm39) missense possibly damaging 0.51
IGL02068:Rpap1 APN 2 119,613,135 (GRCm39) missense probably benign 0.02
IGL02100:Rpap1 APN 2 119,599,807 (GRCm39) missense probably benign 0.06
IGL02528:Rpap1 APN 2 119,605,431 (GRCm39) splice site probably null
IGL02530:Rpap1 APN 2 119,613,720 (GRCm39) splice site probably benign
IGL02747:Rpap1 APN 2 119,604,609 (GRCm39) missense probably damaging 0.98
IGL03371:Rpap1 APN 2 119,605,538 (GRCm39) splice site probably benign
R0138:Rpap1 UTSW 2 119,595,380 (GRCm39) splice site probably null
R0325:Rpap1 UTSW 2 119,602,321 (GRCm39) missense probably benign
R0616:Rpap1 UTSW 2 119,608,601 (GRCm39) missense probably damaging 1.00
R1081:Rpap1 UTSW 2 119,601,750 (GRCm39) missense probably damaging 1.00
R1657:Rpap1 UTSW 2 119,614,259 (GRCm39) missense possibly damaging 0.53
R1837:Rpap1 UTSW 2 119,600,366 (GRCm39) critical splice donor site probably null
R2307:Rpap1 UTSW 2 119,614,247 (GRCm39) missense probably benign 0.00
R2308:Rpap1 UTSW 2 119,614,247 (GRCm39) missense probably benign 0.00
R2375:Rpap1 UTSW 2 119,600,888 (GRCm39) missense possibly damaging 0.50
R2507:Rpap1 UTSW 2 119,610,535 (GRCm39) critical splice donor site probably null
R2508:Rpap1 UTSW 2 119,610,535 (GRCm39) critical splice donor site probably null
R4155:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4156:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4157:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4657:Rpap1 UTSW 2 119,605,487 (GRCm39) missense probably benign 0.03
R4837:Rpap1 UTSW 2 119,608,732 (GRCm39) missense probably benign 0.32
R4880:Rpap1 UTSW 2 119,614,346 (GRCm39) missense probably damaging 0.97
R5010:Rpap1 UTSW 2 119,600,522 (GRCm39) missense probably benign
R5111:Rpap1 UTSW 2 119,601,728 (GRCm39) missense probably damaging 1.00
R5650:Rpap1 UTSW 2 119,604,331 (GRCm39) missense probably benign
R6144:Rpap1 UTSW 2 119,603,128 (GRCm39) nonsense probably null
R6353:Rpap1 UTSW 2 119,607,377 (GRCm39) splice site probably null
R6646:Rpap1 UTSW 2 119,610,612 (GRCm39) missense probably benign 0.03
R6731:Rpap1 UTSW 2 119,608,777 (GRCm39) missense probably benign
R6872:Rpap1 UTSW 2 119,605,850 (GRCm39) missense probably damaging 1.00
R6878:Rpap1 UTSW 2 119,608,657 (GRCm39) missense probably damaging 1.00
R7060:Rpap1 UTSW 2 119,604,043 (GRCm39) missense probably damaging 1.00
R7558:Rpap1 UTSW 2 119,601,735 (GRCm39) missense probably benign
R7640:Rpap1 UTSW 2 119,594,891 (GRCm39) missense possibly damaging 0.63
R7862:Rpap1 UTSW 2 119,605,893 (GRCm39) critical splice acceptor site probably null
R8055:Rpap1 UTSW 2 119,595,284 (GRCm39) missense probably benign 0.13
R8934:Rpap1 UTSW 2 119,599,730 (GRCm39) critical splice donor site probably null
R9220:Rpap1 UTSW 2 119,604,669 (GRCm39) missense probably damaging 0.99
R9422:Rpap1 UTSW 2 119,613,519 (GRCm39) intron probably benign
R9651:Rpap1 UTSW 2 119,598,484 (GRCm39) missense probably damaging 1.00
R9776:Rpap1 UTSW 2 119,607,278 (GRCm39) missense probably benign 0.00
X0028:Rpap1 UTSW 2 119,601,543 (GRCm39) missense probably benign
Z1177:Rpap1 UTSW 2 119,614,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGCCAGTAACTGCTGCTG -3'
(R):5'- ATGAGAAGTGGCCATCTTGC -3'

Sequencing Primer
(F):5'- AGTAACTGCTGCTGCTCCTTCAG -3'
(R):5'- CCAAATGCCTGAAATGCTGTGTG -3'
Posted On 2022-07-20