Incidental Mutation 'R9044:Plxnb2'
ID 720364
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Name plexin B2
Synonyms Debt, 1110007H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock # R9044 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 89155549-89180788 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 89160363 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
AlphaFold B2RXS4
Predicted Effect probably benign
Transcript: ENSMUST00000060808
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109331
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,066,480 Y667* probably null Het
5830411N06Rik G T 7: 140,248,097 G73C probably damaging Het
Acacb A G 5: 114,235,517 H1869R probably benign Het
Adgrb1 A G 15: 74,569,899 T950A possibly damaging Het
Alms1 T A 6: 85,696,753 L3110Q probably damaging Het
Ambra1 A T 2: 91,910,089 probably benign Het
Brpf3 A T 17: 28,806,897 N315Y possibly damaging Het
Cpne7 C T 8: 123,130,212 P402L probably damaging Het
Cyba T A 8: 122,424,891 D189V probably benign Het
Dexi A G 16: 10,503,521 probably benign Het
Dnah2 C T 11: 69,529,421 V156I probably benign Het
Drc7 T C 8: 95,070,449 V420A probably damaging Het
Eef2k T A 7: 120,880,361 V167E probably damaging Het
Efcab1 A G 16: 14,920,397 D142G probably damaging Het
Eid2 T C 7: 28,268,613 I220T possibly damaging Het
Fggy A C 4: 95,844,097 T442P probably benign Het
Foxi3 T G 6: 70,956,699 S57A probably benign Het
Foxi3 T A 6: 70,957,202 probably null Het
Galntl5 C T 5: 25,210,328 P286S possibly damaging Het
Gm5592 A G 7: 41,288,850 K519E probably benign Het
Gse1 T A 8: 120,230,530 S587T unknown Het
Kcns1 G T 2: 164,168,076 F254L probably damaging Het
Kif15 A G 9: 123,011,716 T23A probably benign Het
Kif16b T C 2: 142,699,657 Q1241R possibly damaging Het
Lck A T 4: 129,556,305 L205Q probably damaging Het
Map9 C T 3: 82,380,218 A420V possibly damaging Het
Mdm2 A T 10: 117,695,055 D170E Het
Mllt6 T A 11: 97,663,659 C30S probably damaging Het
Muc5b T G 7: 141,858,058 D1580E unknown Het
Oaf C T 9: 43,224,011 A157T probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr324 T A 11: 58,598,300 N295K possibly damaging Het
Olfr525 A G 7: 140,322,572 probably benign Het
Osbp2 T C 11: 3,717,128 I8V probably damaging Het
Pcdh9 T C 14: 93,886,811 Y641C probably damaging Het
Phf10 A T 17: 14,946,322 C429S probably damaging Het
Plekha6 C G 1: 133,273,949 P367A probably benign Het
Plekha6 C A 1: 133,273,950 P367Q possibly damaging Het
Plod2 T A 9: 92,607,220 I756K probably damaging Het
Pop1 T A 15: 34,530,408 M1014K possibly damaging Het
Prrt4 T C 6: 29,171,541 D304G probably benign Het
Rcan2 C A 17: 43,836,354 L28I probably benign Het
Rffl C T 11: 82,810,194 V269I probably benign Het
Rhox3c C T X: 37,469,650 probably benign Het
Ric1 C T 19: 29,599,894 A1066V probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr2 A T 13: 11,738,103 Y1777* probably null Het
Sh3tc1 T G 5: 35,697,490 K1288Q possibly damaging Het
Slc10a5 A C 3: 10,334,732 I289M probably damaging Het
Slc16a9 A G 10: 70,274,967 T128A probably benign Het
Slc7a11 T C 3: 50,379,183 H373R probably benign Het
Spesp1 A G 9: 62,273,341 I95T probably benign Het
Sra1 C T 18: 36,667,893 V131I probably benign Het
Stxbp5l A G 16: 37,204,568 V556A possibly damaging Het
Sycp2 T C 2: 178,347,824 E1414G probably damaging Het
Trac A T 14: 54,220,691 K57* probably null Het
Trps1 T C 15: 50,822,607 E724G probably benign Het
Tubgcp6 T G 15: 89,103,194 D1192A possibly damaging Het
Usp48 G A 4: 137,613,685 G332E probably benign Het
Vps18 T G 2: 119,297,553 I952M probably damaging Het
Wdr36 T C 18: 32,837,446 F20S probably damaging Het
Wdr62 C A 7: 30,262,637 R450L probably benign Het
Xab2 T C 8: 3,618,641 K76E probably benign Het
Zpr1 A G 9: 46,279,697 D300G probably damaging Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3752:Plxnb2 UTSW 15 89157255 splice site probably benign
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89157022 missense possibly damaging 0.89
R8126:Plxnb2 UTSW 15 89163303 missense probably benign
R8131:Plxnb2 UTSW 15 89158713 missense probably damaging 1.00
R8372:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R8736:Plxnb2 UTSW 15 89162058 missense probably damaging 1.00
R8772:Plxnb2 UTSW 15 89162746 missense probably damaging 1.00
R9022:Plxnb2 UTSW 15 89164268 missense possibly damaging 0.59
R9253:Plxnb2 UTSW 15 89167812 missense probably benign
R9398:Plxnb2 UTSW 15 89160919 missense probably benign 0.02
R9562:Plxnb2 UTSW 15 89165933 missense probably damaging 1.00
R9568:Plxnb2 UTSW 15 89160957 nonsense probably null
R9613:Plxnb2 UTSW 15 89164293 missense probably benign 0.01
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAATTCCTTCTTGCAGCG -3'
(R):5'- AGTTCATTGTGCGTGAGAGC -3'

Sequencing Primer
(F):5'- TTCTTGCAGCGGTCACG -3'
(R):5'- TCTCAGGAGAAGCCGCC -3'
Posted On 2022-07-20