Mutagenetix > Incidental Mutation

Incidental Mutation 'R8973:Tbcd'

720384

Institutional Source

Beutler Lab

Gene Symbol

Tbcd

Ensembl Gene

ENSMUSG00000039230

Gene Name

tubulin-specific chaperone d

Synonyms

2310057L06Rik, A030005L14Rik

MMRRC Submission

068807-MU

Accession Numbers

Ncbi RefSeq: NM_029878.3; MGI:1919686

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R8973 (G1)

Quality Score

197.009

Status

Validated

Chromosome

Chromosomal Location

121451949-121617164 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to C at 121496853 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103013] [ENSMUST00000106093]

AlphaFold

Q8BYA0

Predicted Effect

probably benign
Transcript: ENSMUST00000103013

SMART Domains

Protein: ENSMUSP00000099302
Gene: ENSMUSG00000039230

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
low complexity region	45	62	N/A	INTRINSIC
SCOP:d1b3ua_	357	742	4e-20	SMART
Pfam:TFCD_C	900	1090	1.4e-74	PFAM
low complexity region	1113	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106093

Predicted Effect

probably benign
Transcript: ENSMUST00000125167

SMART Domains

Protein: ENSMUSP00000124735
Gene: ENSMUSG00000039230

Domain	Start	End	E-Value	Type
low complexity region	36	58	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (77/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cofactor D is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	T	G	18: 57,592,067	L123V	possibly damaging	Het
1810022K09Rik	C	T	3: 14,607,245	V97I	probably benign	Het
2410089E03Rik	T	C	15: 8,203,793	W1201R	probably damaging	Het
4930404N11Rik	T	C	10: 81,364,015	D129G	unknown	Het
Adamts16	A	T	13: 70,738,840	I975N	probably benign	Het
Adcy8	A	G	15: 64,699,135	*1250Q	probably null	Het
Anapc1	A	T	2: 128,664,032	I628N	probably damaging	Het
Ankrd39	C	T	1: 36,539,358		probably benign	Het
Ankub1	A	T	3: 57,665,511	S263R	possibly damaging	Het
Aoah	A	G	13: 20,840,155	I94V	probably benign	Het
Aox2	A	G	1: 58,289,954	D186G	probably benign	Het
Arap2	A	T	5: 62,698,325	C589*	probably null	Het
Armt1	T	C	10: 4,439,550	L69P	probably damaging	Het
Atxn7l3	T	A	11: 102,292,772	Y185F	probably benign	Het
BC067074	A	G	13: 113,319,759	T780A		Het
Cacna2d4	A	G	6: 119,241,181	D159G	probably damaging	Het
Camta2	C	A	11: 70,670,358	R1184L	probably benign	Het
Ccr7	G	A	11: 99,145,823	T91I	probably damaging	Het
Cdh9	A	G	15: 16,831,045	T323A	possibly damaging	Het
Cep250	C	T	2: 155,970,122	A446V	unknown	Het
Clec2e	C	A	6: 129,093,411	G216*	probably null	Het
Col25a1	T	C	3: 130,475,626	S176P	unknown	Het
Col4a3	A	C	1: 82,715,331	I1446L	probably benign	Het
Cse1l	A	G	2: 166,943,080	E823G	probably damaging	Het
Dchs2	A	G	3: 83,354,456	E2677G	possibly damaging	Het
Dis3l	T	C	9: 64,339,542	E77G	probably damaging	Het
Dnah6	T	C	6: 73,144,751	D1416G	probably benign	Het
Dpyd	T	C	3: 119,314,933		probably null	Het
Dst	A	G	1: 34,228,855	D3112G	probably damaging	Het
Dusp13	A	C	14: 21,734,906	N128K	probably benign	Het
Emilin2	T	G	17: 71,275,084	K216Q	probably benign	Het
Enam	T	C	5: 88,494,088	W254R	possibly damaging	Het
Esrrg	A	C	1: 188,198,750	N346T	possibly damaging	Het
Fbn2	C	T	18: 58,153,856	G244R	probably damaging	Het
Fbxw25	A	G	9: 109,650,064	L373P		Het
Gm21060	C	A	19: 61,296,928	V48L	possibly damaging	Het
Gm30302	A	T	13: 49,788,239	D80E	probably benign	Het
Gtpbp3	T	C	8: 71,491,162	V254A	possibly damaging	Het
H2-DMb2	A	G	17: 34,148,725	D171G	probably damaging	Het
Hrg	A	T	16: 22,959,218	T242S	probably benign	Het
Inf2	G	T	12: 112,607,515	C751F	unknown	Het
Krt13	A	T	11: 100,119,438	M239K	possibly damaging	Het
Lrrc72	A	G	12: 36,253,294	S7P	probably benign	Het
Matn2	A	G	15: 34,433,050	I867V	probably benign	Het
Mdh2	C	T	5: 135,790,165	A325V	possibly damaging	Het
Mki67	C	A	7: 135,695,635	A2557S	possibly damaging	Het
Mrpl16	A	T	19: 11,772,943	R64*	probably null	Het
Nav1	T	C	1: 135,584,725	D199G	probably benign	Het
Nbn	T	C	4: 15,986,585	V662A	probably damaging	Het
Nek10	G	A	14: 14,931,321		probably null	Het
Olfr141	C	A	2: 86,806,856	V48F	probably benign	Het
Olfr298	A	G	7: 86,489,279	S91P	probably damaging	Het
Olfr834	C	A	9: 18,988,678	S230*	probably null	Het
Olfr884	T	A	9: 38,047,543	V107D	possibly damaging	Het
Pcsk7	T	G	9: 45,927,642	S617R	probably benign	Het
Pde10a	C	A	17: 8,924,239	Q6K	probably benign	Het
Pigq	A	C	17: 25,932,167	M396R	probably damaging	Het
Pkhd1l1	T	A	15: 44,586,437	D3865E	probably damaging	Het
Prag1	C	T	8: 36,099,590		probably benign	Het
Rint1	A	G	5: 23,811,730	T498A	probably benign	Het
Rnf213	T	A	11: 119,461,930	F3921I		Het
Rpp14	A	G	14: 8,088,768	S95G	probably benign	Het
Ryk	T	G	9: 102,861,921	Y78D	possibly damaging	Het
Sez6	A	T	11: 77,974,571	Q678L	probably damaging	Het
Slc22a21	T	C	11: 53,969,576	K141E	probably damaging	Het
Slc30a5	A	T	13: 100,806,694	I609K	probably damaging	Het
Slc44a4	T	C	17: 34,921,562	F244L	probably damaging	Het
Susd5	T	C	9: 114,082,504	Y161H	possibly damaging	Het
Syne3	A	G	12: 104,959,395		probably null	Het
Tmc1	A	T	19: 20,900,851	N93K	probably benign	Het
Tmem100	T	A	11: 90,035,476	M43K	probably benign	Het
Tmem131l	A	T	3: 83,928,732	V690D	probably damaging	Het
Trim8	A	G	19: 46,515,464	Q485R	possibly damaging	Het
Vmn2r63	A	T	7: 42,928,495	H206Q	probably benign	Het
Vmn2r77	T	A	7: 86,802,942	N443K	possibly damaging	Het
Zan	T	A	5: 137,389,316	I4878F	unknown	Het
Zfand4	A	G	6: 116,314,080	D344G	probably benign	Het

Other mutations in Tbcd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Tbcd	APN	11	121575321	missense	probably damaging	0.96
IGL00795:Tbcd	APN	11	121616932	missense	probably benign
IGL00802:Tbcd	APN	11	121608610	missense	possibly damaging	0.55
IGL01286:Tbcd	APN	11	121493893	critical splice donor site	probably null
IGL01325:Tbcd	APN	11	121540993	missense	probably damaging	0.99
IGL01348:Tbcd	APN	11	121497076	missense	probably benign
IGL01432:Tbcd	APN	11	121475680	splice site	probably benign
IGL01577:Tbcd	APN	11	121497012	missense	probably damaging	1.00
IGL01660:Tbcd	APN	11	121605327	missense	probably benign	0.01
IGL01865:Tbcd	APN	11	121590380	missense	possibly damaging	0.81
IGL02260:Tbcd	APN	11	121603278	missense	probably damaging	1.00
IGL02492:Tbcd	APN	11	121497134	missense	probably benign	0.06
IGL02620:Tbcd	APN	11	121461255	missense	probably damaging	1.00
IGL02950:Tbcd	APN	11	121603709	missense	probably damaging	0.99
R6859_Tbcd_818	UTSW	11	121497111	missense	possibly damaging	0.81
R0066:Tbcd	UTSW	11	121503764	nonsense	probably null
R0066:Tbcd	UTSW	11	121503764	nonsense	probably null
R0077:Tbcd	UTSW	11	121594274	missense	probably benign	0.00
R0349:Tbcd	UTSW	11	121602983	splice site	probably null
R0865:Tbcd	UTSW	11	121602989	missense	possibly damaging	0.88
R1203:Tbcd	UTSW	11	121475625	missense	probably benign	0.00
R1221:Tbcd	UTSW	11	121497083	missense	probably benign	0.00
R1549:Tbcd	UTSW	11	121560753	missense	probably benign
R1586:Tbcd	UTSW	11	121497060	missense	probably benign	0.13
R1671:Tbcd	UTSW	11	121597294	missense	probably benign	0.00
R2048:Tbcd	UTSW	11	121540936	missense	probably damaging	1.00
R2051:Tbcd	UTSW	11	121453670	missense	probably damaging	1.00
R2124:Tbcd	UTSW	11	121603320	missense	probably damaging	1.00
R2151:Tbcd	UTSW	11	121603631	missense	possibly damaging	0.95
R2153:Tbcd	UTSW	11	121603631	missense	possibly damaging	0.95
R3120:Tbcd	UTSW	11	121608648	missense	probably damaging	0.97
R4108:Tbcd	UTSW	11	121493811	missense	probably benign	0.00
R4244:Tbcd	UTSW	11	121594281	missense	probably damaging	1.00
R4587:Tbcd	UTSW	11	121605271	missense	possibly damaging	0.75
R4684:Tbcd	UTSW	11	121493771	missense	probably damaging	1.00
R4837:Tbcd	UTSW	11	121582785	critical splice donor site	probably null
R4861:Tbcd	UTSW	11	121601961	missense	probably damaging	1.00
R4861:Tbcd	UTSW	11	121601961	missense	probably damaging	1.00
R4960:Tbcd	UTSW	11	121573855	missense	probably benign	0.03
R5157:Tbcd	UTSW	11	121610027	missense	probably benign	0.14
R5166:Tbcd	UTSW	11	121609390	missense	possibly damaging	0.87
R5403:Tbcd	UTSW	11	121560743	missense	probably damaging	0.99
R5406:Tbcd	UTSW	11	121452101	missense	probably benign
R5509:Tbcd	UTSW	11	121602012	missense	probably benign	0.00
R5767:Tbcd	UTSW	11	121592692	missense	probably benign	0.00
R5923:Tbcd	UTSW	11	121580152	missense	probably benign
R5966:Tbcd	UTSW	11	121601911	intron	probably benign
R6330:Tbcd	UTSW	11	121497086	missense	probably benign
R6539:Tbcd	UTSW	11	121556987	critical splice donor site	probably null
R6852:Tbcd	UTSW	11	121609380	missense	probably benign	0.36
R6859:Tbcd	UTSW	11	121497111	missense	possibly damaging	0.81
R7348:Tbcd	UTSW	11	121594311	missense	probably benign	0.22
R7479:Tbcd	UTSW	11	121492605	critical splice donor site	probably null
R7679:Tbcd	UTSW	11	121603708	missense	probably benign	0.01
R8121:Tbcd	UTSW	11	121597143	splice site	probably null
R8163:Tbcd	UTSW	11	121493885	missense	probably benign	0.00
R8165:Tbcd	UTSW	11	121493885	missense	probably benign	0.00
R8172:Tbcd	UTSW	11	121493885	missense	probably benign	0.00
R8975:Tbcd	UTSW	11	121496853	unclassified	probably benign
R9314:Tbcd	UTSW	11	121596471	missense	probably benign	0.01
R9345:Tbcd	UTSW	11	121573822	missense	probably damaging	1.00
R9556:Tbcd	UTSW	11	121576227	missense	probably damaging	0.96
R9673:Tbcd	UTSW	11	121573821	missense	probably damaging	1.00
Z1177:Tbcd	UTSW	11	121590406	missense	probably null	0.14

Predicted Primers

PCR Primer
(F):5'- TTTCTTGTTCCCAGGCAAGTG -3'
(R):5'- CTTCAGGTTAGCAGCCAAAGAC -3'

Sequencing Primer
(F):5'- GAGATCCCTTTTGCCTGGGC -3'
(R):5'- GTTAGCAGCCAAAGACCGACAG -3'

Posted On

2022-07-29