Incidental Mutation 'R9120:Col9a2'
ID 720401
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9120 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 121039385-121055322 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 121043754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030372
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 40,756,104 probably benign Het
Adgrb2 A G 4: 130,012,509 N910S possibly damaging Het
Arhgap24 A T 5: 102,892,150 I411F probably benign Het
BC030500 T A 8: 58,912,877 L15Q unknown Het
BC051665 A G 13: 60,785,102 V15A probably benign Het
Bicc1 T C 10: 70,941,032 D732G probably damaging Het
Bpifb1 A G 2: 154,204,772 I71V probably benign Het
Btnl1 A T 17: 34,379,707 Q99L possibly damaging Het
D7Ertd443e T A 7: 134,270,257 D625V probably damaging Het
Dchs2 A T 3: 83,280,228 D1327V probably damaging Het
Ddx1 A G 12: 13,225,457 V543A possibly damaging Het
Dgkz G T 2: 91,938,200 D714E probably benign Het
Dlk1 A G 12: 109,458,125 D105G probably benign Het
Fndc3a A G 14: 72,564,693 F557L probably benign Het
Gatsl3 T A 11: 4,220,767 V196D possibly damaging Het
Gm28042 C T 2: 120,038,981 L609F probably damaging Het
Gsap A G 5: 21,253,436 I473V probably damaging Het
Jag1 A T 2: 137,088,434 M730K probably benign Het
Kazald1 A T 19: 45,076,772 T31S probably benign Het
Ldhb A G 6: 142,494,209 W202R probably damaging Het
Lrrcc1 C T 3: 14,550,429 Q528* probably null Het
Magi2 A T 5: 20,528,307 K525I possibly damaging Het
Map2 A G 1: 66,414,059 I703V probably damaging Het
Mdn1 A T 4: 32,701,814 M1516L probably damaging Het
Mpzl2 T A 9: 45,047,285 S186R probably benign Het
Mtif2 T C 11: 29,533,951 M208T probably benign Het
Myo3a T C 2: 22,544,426 V873A probably benign Het
Olfr1166 A G 2: 88,124,779 S69P probably damaging Het
Olfr350 T A 2: 36,850,131 Y28* probably null Het
Olfr455 A C 6: 42,538,649 Y124* probably null Het
Olfr478 T C 7: 108,031,680 Y221C probably damaging Het
Olfr919 A G 9: 38,697,439 F309S probably benign Het
Plod2 G T 9: 92,542,327 probably benign Het
Rgs14 A C 13: 55,380,979 D311A probably damaging Het
Rin1 C A 19: 5,053,020 P446T probably damaging Het
Ripor3 T C 2: 167,980,915 K909E possibly damaging Het
Rnf139 T C 15: 58,899,836 L570P probably damaging Het
Snx17 A G 5: 31,197,682 E347G probably damaging Het
Spaca1 A G 4: 34,029,168 S220P probably damaging Het
Spen G T 4: 141,472,922 T2798K Het
Tacc1 G T 8: 25,169,239 S570R probably damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem246 A G 4: 49,587,093 V25A probably benign Het
Trim63 G A 4: 134,327,692 probably benign Het
Trmt2a C A 16: 18,249,858 R132S probably damaging Het
Ttn T C 2: 76,938,372 E2952G unknown Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn1r211 A T 13: 22,851,766 F244I probably damaging Het
Vmn2r86 T G 10: 130,453,808 S73R probably benign Het
Wdr27 A G 17: 14,932,584 L87P probably damaging Het
Zfp148 A G 16: 33,497,226 N756S probably benign Het
Zfp57 G A 17: 37,009,758 R168H probably benign Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 121045192 missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 121044666 missense unknown
IGL01995:Col9a2 APN 4 121050410 critical splice donor site probably null
IGL02162:Col9a2 APN 4 121054334 unclassified probably benign
IGL02931:Col9a2 APN 4 121053192 missense probably benign 0.06
collision UTSW 4 121049716 critical splice donor site probably null
gravity_wave UTSW 4 121044019 critical splice donor site probably null
R0208:Col9a2 UTSW 4 121052288 splice site probably benign
R0426:Col9a2 UTSW 4 121044660 splice site probably benign
R0512:Col9a2 UTSW 4 121054307 missense probably benign 0.22
R0973:Col9a2 UTSW 4 121039788 critical splice donor site probably null
R1023:Col9a2 UTSW 4 121044010 missense unknown
R1657:Col9a2 UTSW 4 121040974 missense unknown
R1724:Col9a2 UTSW 4 121053902 missense probably damaging 1.00
R2171:Col9a2 UTSW 4 121045001 nonsense probably null
R2206:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2221:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2223:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2273:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2274:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2275:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2354:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2392:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2393:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2394:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3421:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3426:Col9a2 UTSW 4 121050407 missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3821:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3838:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3839:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4067:Col9a2 UTSW 4 121052389 missense probably damaging 1.00
R4298:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4299:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4595:Col9a2 UTSW 4 121045155 missense probably benign 0.04
R4942:Col9a2 UTSW 4 121053119 missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 121039772 missense unknown
R5434:Col9a2 UTSW 4 121040965 nonsense probably null
R6143:Col9a2 UTSW 4 121053863 missense probably damaging 0.99
R7027:Col9a2 UTSW 4 121044019 critical splice donor site probably null
R7056:Col9a2 UTSW 4 121049716 critical splice donor site probably null
R7417:Col9a2 UTSW 4 121054292 missense not run
R7571:Col9a2 UTSW 4 121039784 missense unknown
R9341:Col9a2 UTSW 4 121054286 missense probably benign 0.03
R9343:Col9a2 UTSW 4 121054286 missense probably benign 0.03
R9389:Col9a2 UTSW 4 121054751 missense probably benign 0.00
R9527:Col9a2 UTSW 4 121042331 critical splice donor site probably null
R9620:Col9a2 UTSW 4 121053206 critical splice donor site probably null
R9784:Col9a2 UTSW 4 121041029 missense unknown
Z1176:Col9a2 UTSW 4 121053797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGAGGAAGGTATGGTCCC -3'
(R):5'- CAGATTAATGGCTCCCCTCTGC -3'

Sequencing Primer
(F):5'- AAGGTATGGTCCCCAGGC -3'
(R):5'- AATGGCTCCCCTCTGCAAGTC -3'
Posted On 2022-08-08