Incidental Mutation 'R9120:Col9a2'
ID 720401
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Name collagen, type IX, alpha 2
Synonyms Col9a-2
MMRRC Submission 068923-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9120 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 120896763-120912522 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 120900951 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030372
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,209,141 (GRCm39) probably benign Het
Adgrb2 A G 4: 129,906,302 (GRCm39) N910S possibly damaging Het
Arhgap24 A T 5: 103,040,016 (GRCm39) I411F probably benign Het
BC030500 T A 8: 59,365,911 (GRCm39) L15Q unknown Het
BC051665 A G 13: 60,932,916 (GRCm39) V15A probably benign Het
Bicc1 T C 10: 70,776,862 (GRCm39) D732G probably damaging Het
Bpifb1 A G 2: 154,046,692 (GRCm39) I71V probably benign Het
Btnl1 A T 17: 34,598,681 (GRCm39) Q99L possibly damaging Het
Castor1 T A 11: 4,170,767 (GRCm39) V196D possibly damaging Het
D7Ertd443e T A 7: 133,871,986 (GRCm39) D625V probably damaging Het
Dchs2 A T 3: 83,187,535 (GRCm39) D1327V probably damaging Het
Ddx1 A G 12: 13,275,458 (GRCm39) V543A possibly damaging Het
Dgkz G T 2: 91,768,545 (GRCm39) D714E probably benign Het
Dlk1 A G 12: 109,424,051 (GRCm39) D105G probably benign Het
Fndc3a A G 14: 72,802,133 (GRCm39) F557L probably benign Het
Gm28042 C T 2: 119,869,462 (GRCm39) L609F probably damaging Het
Gsap A G 5: 21,458,434 (GRCm39) I473V probably damaging Het
Jag1 A T 2: 136,930,354 (GRCm39) M730K probably benign Het
Kazald1 A T 19: 45,065,211 (GRCm39) T31S probably benign Het
Ldhb A G 6: 142,439,935 (GRCm39) W202R probably damaging Het
Lrrcc1 C T 3: 14,615,489 (GRCm39) Q528* probably null Het
Magi2 A T 5: 20,733,305 (GRCm39) K525I possibly damaging Het
Map2 A G 1: 66,453,218 (GRCm39) I703V probably damaging Het
Mdn1 A T 4: 32,701,814 (GRCm39) M1516L probably damaging Het
Mpzl2 T A 9: 44,958,583 (GRCm39) S186R probably benign Het
Mtif2 T C 11: 29,483,951 (GRCm39) M208T probably benign Het
Myo3a T C 2: 22,436,464 (GRCm39) V873A probably benign Het
Or10ac1 A C 6: 42,515,583 (GRCm39) Y124* probably null Het
Or1j4 T A 2: 36,740,143 (GRCm39) Y28* probably null Het
Or5d38 A G 2: 87,955,123 (GRCm39) S69P probably damaging Het
Or5p6 T C 7: 107,630,887 (GRCm39) Y221C probably damaging Het
Or8g51 A G 9: 38,608,735 (GRCm39) F309S probably benign Het
Pgap4 A G 4: 49,587,093 (GRCm39) V25A probably benign Het
Plod2 G T 9: 92,424,380 (GRCm39) probably benign Het
Rgs14 A C 13: 55,528,792 (GRCm39) D311A probably damaging Het
Rin1 C A 19: 5,103,048 (GRCm39) P446T probably damaging Het
Ripor3 T C 2: 167,822,835 (GRCm39) K909E possibly damaging Het
Rnf139 T C 15: 58,771,685 (GRCm39) L570P probably damaging Het
Snx17 A G 5: 31,355,026 (GRCm39) E347G probably damaging Het
Spaca1 A G 4: 34,029,168 (GRCm39) S220P probably damaging Het
Spen G T 4: 141,200,233 (GRCm39) T2798K Het
Tacc1 G T 8: 25,659,255 (GRCm39) S570R probably damaging Het
Tmem135 G C 7: 88,797,186 (GRCm39) L357V probably benign Het
Trim63 G A 4: 134,055,003 (GRCm39) probably benign Het
Trmt2a C A 16: 18,067,722 (GRCm39) R132S probably damaging Het
Ttn T C 2: 76,768,716 (GRCm39) E2952G unknown Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn1r211 A T 13: 23,035,936 (GRCm39) F244I probably damaging Het
Vmn2r86 T G 10: 130,289,677 (GRCm39) S73R probably benign Het
Wdr27 A G 17: 15,152,846 (GRCm39) L87P probably damaging Het
Zfp148 A G 16: 33,317,596 (GRCm39) N756S probably benign Het
Zfp57 G A 17: 37,320,650 (GRCm39) R168H probably benign Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 120,902,389 (GRCm39) missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 120,901,863 (GRCm39) missense unknown
IGL01995:Col9a2 APN 4 120,907,607 (GRCm39) critical splice donor site probably null
IGL02162:Col9a2 APN 4 120,911,531 (GRCm39) unclassified probably benign
IGL02931:Col9a2 APN 4 120,910,389 (GRCm39) missense probably benign 0.06
collision UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
gravity_wave UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R0208:Col9a2 UTSW 4 120,909,485 (GRCm39) splice site probably benign
R0426:Col9a2 UTSW 4 120,901,857 (GRCm39) splice site probably benign
R0512:Col9a2 UTSW 4 120,911,504 (GRCm39) missense probably benign 0.22
R0973:Col9a2 UTSW 4 120,896,985 (GRCm39) critical splice donor site probably null
R1023:Col9a2 UTSW 4 120,901,207 (GRCm39) missense unknown
R1657:Col9a2 UTSW 4 120,898,171 (GRCm39) missense unknown
R1724:Col9a2 UTSW 4 120,911,099 (GRCm39) missense probably damaging 1.00
R2171:Col9a2 UTSW 4 120,902,198 (GRCm39) nonsense probably null
R2206:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2221:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2223:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2273:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2274:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2275:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2354:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2392:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2393:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R2394:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3421:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3426:Col9a2 UTSW 4 120,907,604 (GRCm39) missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3821:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3838:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R3839:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4067:Col9a2 UTSW 4 120,909,586 (GRCm39) missense probably damaging 1.00
R4298:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4299:Col9a2 UTSW 4 120,911,455 (GRCm39) missense probably damaging 0.98
R4595:Col9a2 UTSW 4 120,902,352 (GRCm39) missense probably benign 0.04
R4942:Col9a2 UTSW 4 120,910,316 (GRCm39) missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 120,896,969 (GRCm39) missense unknown
R5434:Col9a2 UTSW 4 120,898,162 (GRCm39) nonsense probably null
R6143:Col9a2 UTSW 4 120,911,060 (GRCm39) missense probably damaging 0.99
R7027:Col9a2 UTSW 4 120,901,216 (GRCm39) critical splice donor site probably null
R7056:Col9a2 UTSW 4 120,906,913 (GRCm39) critical splice donor site probably null
R7417:Col9a2 UTSW 4 120,911,489 (GRCm39) missense not run
R7571:Col9a2 UTSW 4 120,896,981 (GRCm39) missense unknown
R9341:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9343:Col9a2 UTSW 4 120,911,483 (GRCm39) missense probably benign 0.03
R9389:Col9a2 UTSW 4 120,911,948 (GRCm39) missense probably benign 0.00
R9527:Col9a2 UTSW 4 120,899,528 (GRCm39) critical splice donor site probably null
R9620:Col9a2 UTSW 4 120,910,403 (GRCm39) critical splice donor site probably null
R9784:Col9a2 UTSW 4 120,898,226 (GRCm39) missense unknown
Z1176:Col9a2 UTSW 4 120,910,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGAGGAAGGTATGGTCCC -3'
(R):5'- CAGATTAATGGCTCCCCTCTGC -3'

Sequencing Primer
(F):5'- AAGGTATGGTCCCCAGGC -3'
(R):5'- AATGGCTCCCCTCTGCAAGTC -3'
Posted On 2022-08-08