Incidental Mutation 'R9550:Dnajc16'
ID 720426
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.724) question?
Stock # R9550 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141495058 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 518 (Y518C)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038014
AA Change: Y518C

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: Y518C

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 44,022,120 (GRCm39) C457R probably damaging Het
Adamts9 A T 6: 92,878,429 (GRCm39) V546E probably benign Het
Add3 G A 19: 53,233,521 (GRCm39) E641K possibly damaging Het
Anks1b T A 10: 90,412,360 (GRCm39) M1K probably null Het
C1s2 G A 6: 124,605,253 (GRCm39) Q361* probably null Het
Casp4 T C 9: 5,328,465 (GRCm39) S316P probably damaging Het
Cby2 A G 14: 75,820,603 (GRCm39) V374A probably damaging Het
Cdyl A G 13: 36,000,147 (GRCm39) T143A probably benign Het
Cep85 T C 4: 133,858,598 (GRCm39) T760A probably damaging Het
Chd2 A G 7: 73,119,439 (GRCm39) L1035P probably damaging Het
Cpne8 T C 15: 90,453,760 (GRCm39) I208V probably benign Het
Cux1 A G 5: 136,340,387 (GRCm39) L641P probably damaging Het
Dlgap1 T A 17: 71,093,902 (GRCm39) M741K possibly damaging Het
Dtnb A G 12: 3,768,437 (GRCm39) N343D possibly damaging Het
Dusp3 A T 11: 101,872,668 (GRCm39) S43T probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Espn C T 4: 152,215,534 (GRCm39) R575H probably damaging Het
Gls A T 1: 52,251,373 (GRCm39) L328* probably null Het
H2-T23 T C 17: 36,342,712 (GRCm39) D142G probably damaging Het
Hck A G 2: 152,976,651 (GRCm39) M262V probably benign Het
Igkv14-126 G T 6: 67,873,199 (GRCm39) L13F possibly damaging Het
Muc2 C T 7: 141,308,242 (GRCm39) R913C probably damaging Het
Mypop A T 7: 18,726,245 (GRCm39) T71S probably damaging Het
Nadsyn1 A G 7: 143,353,615 (GRCm39) I536T probably damaging Het
Obsl1 T C 1: 75,474,910 (GRCm39) E830G possibly damaging Het
Or1q1 T A 2: 36,887,137 (GRCm39) I105N probably damaging Het
Or8d2b T C 9: 38,788,937 (GRCm39) V155A probably benign Het
Pcdha8 A T 18: 37,127,399 (GRCm39) Y627F possibly damaging Het
Polr1b T A 2: 128,962,205 (GRCm39) S742R unknown Het
Ppm1e A T 11: 87,121,919 (GRCm39) N679K probably benign Het
Raly AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG AGCAGCAGTGGTGGAGG 2: 154,705,754 (GRCm39) probably benign Het
Rgs12 G T 5: 35,196,665 (GRCm39) G1430C probably damaging Het
Rhcg T C 7: 79,248,296 (GRCm39) Y436C probably damaging Het
Ripor3 T C 2: 167,822,807 (GRCm39) D918G probably benign Het
Rlf A G 4: 121,003,620 (GRCm39) F1897L probably damaging Het
Sin3a T C 9: 56,996,768 (GRCm39) V99A probably benign Het
Slc22a29 A T 19: 8,195,224 (GRCm39) L137* probably null Het
Sufu A G 19: 46,385,675 (GRCm39) Y45C probably damaging Het
Thsd1 C T 8: 22,733,026 (GRCm39) probably benign Het
Tiam2 T A 17: 3,559,706 (GRCm39) L1249Q probably damaging Het
Toe1 C T 4: 116,661,916 (GRCm39) V418M probably benign Het
Trappc12 T C 12: 28,761,985 (GRCm39) probably null Het
Triobp A G 15: 78,858,077 (GRCm39) D1226G probably damaging Het
Zfhx4 T C 3: 5,464,572 (GRCm39) S1602P probably damaging Het
Zfp266 T C 9: 20,410,482 (GRCm39) K565R probably damaging Het
Zfp319 T C 8: 96,055,025 (GRCm39) T393A probably benign Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141,491,124 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACCTATCAGCAAATGGTAAGAAGC -3'
(R):5'- GCGGAAGGATCCAGCATTTC -3'

Sequencing Primer
(F):5'- TATCAGCAAATGGTAAGAAGCAAAGC -3'
(R):5'- GAAGGATCCAGCATTTCTGTCTTCAG -3'
Posted On 2022-08-09