Incidental Mutation 'R9550:Rgs12'
ID 720428
Institutional Source Beutler Lab
Gene Symbol Rgs12
Ensembl Gene ENSMUSG00000029101
Gene Name regulator of G-protein signaling 12
Synonyms 4632412M04Rik, 1200016K18Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R9550 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 35106789-35196988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 35196665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 1430 (G1430C)
Ref Sequence ENSEMBL: ENSMUSP00000084970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030985] [ENSMUST00000087684] [ENSMUST00000114283] [ENSMUST00000114285] [ENSMUST00000202573]
AlphaFold Q8CGE9
Predicted Effect probably benign
Transcript: ENSMUST00000030985
SMART Domains Protein: ENSMUSP00000030985
Gene: ENSMUSG00000029102

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
FN2 98 145 7.31e-27 SMART
EGF 160 195 2.11e-4 SMART
Pfam:fn1 199 234 7.7e-11 PFAM
EGF 241 276 1.69e-3 SMART
KR 281 366 5.2e-36 SMART
Tryp_SPc 405 639 2.07e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087684
AA Change: G1430C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101
AA Change: G1430C

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114283
AA Change: G772C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109922
Gene: ENSMUSG00000029101
AA Change: G772C

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114285
AA Change: G782C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109924
Gene: ENSMUSG00000029101
AA Change: G782C

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 707 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150139
SMART Domains Protein: ENSMUSP00000117158
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
Blast:RBD 2 33 5e-13 BLAST
Pfam:RGS12_us2 35 80 5.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202573
SMART Domains Protein: ENSMUSP00000144344
Gene: ENSMUSG00000029102

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 44,022,120 (GRCm39) C457R probably damaging Het
Adamts9 A T 6: 92,878,429 (GRCm39) V546E probably benign Het
Add3 G A 19: 53,233,521 (GRCm39) E641K possibly damaging Het
Anks1b T A 10: 90,412,360 (GRCm39) M1K probably null Het
C1s2 G A 6: 124,605,253 (GRCm39) Q361* probably null Het
Casp4 T C 9: 5,328,465 (GRCm39) S316P probably damaging Het
Cby2 A G 14: 75,820,603 (GRCm39) V374A probably damaging Het
Cdyl A G 13: 36,000,147 (GRCm39) T143A probably benign Het
Cep85 T C 4: 133,858,598 (GRCm39) T760A probably damaging Het
Chd2 A G 7: 73,119,439 (GRCm39) L1035P probably damaging Het
Cpne8 T C 15: 90,453,760 (GRCm39) I208V probably benign Het
Cux1 A G 5: 136,340,387 (GRCm39) L641P probably damaging Het
Dlgap1 T A 17: 71,093,902 (GRCm39) M741K possibly damaging Het
Dnajc16 T C 4: 141,495,058 (GRCm39) Y518C possibly damaging Het
Dtnb A G 12: 3,768,437 (GRCm39) N343D possibly damaging Het
Dusp3 A T 11: 101,872,668 (GRCm39) S43T probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Espn C T 4: 152,215,534 (GRCm39) R575H probably damaging Het
Gls A T 1: 52,251,373 (GRCm39) L328* probably null Het
H2-T23 T C 17: 36,342,712 (GRCm39) D142G probably damaging Het
Hck A G 2: 152,976,651 (GRCm39) M262V probably benign Het
Igkv14-126 G T 6: 67,873,199 (GRCm39) L13F possibly damaging Het
Muc2 C T 7: 141,308,242 (GRCm39) R913C probably damaging Het
Mypop A T 7: 18,726,245 (GRCm39) T71S probably damaging Het
Nadsyn1 A G 7: 143,353,615 (GRCm39) I536T probably damaging Het
Obsl1 T C 1: 75,474,910 (GRCm39) E830G possibly damaging Het
Or1q1 T A 2: 36,887,137 (GRCm39) I105N probably damaging Het
Or8d2b T C 9: 38,788,937 (GRCm39) V155A probably benign Het
Pcdha8 A T 18: 37,127,399 (GRCm39) Y627F possibly damaging Het
Polr1b T A 2: 128,962,205 (GRCm39) S742R unknown Het
Ppm1e A T 11: 87,121,919 (GRCm39) N679K probably benign Het
Raly AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG AGCAGCAGTGGTGGAGG 2: 154,705,754 (GRCm39) probably benign Het
Rhcg T C 7: 79,248,296 (GRCm39) Y436C probably damaging Het
Ripor3 T C 2: 167,822,807 (GRCm39) D918G probably benign Het
Rlf A G 4: 121,003,620 (GRCm39) F1897L probably damaging Het
Sin3a T C 9: 56,996,768 (GRCm39) V99A probably benign Het
Slc22a29 A T 19: 8,195,224 (GRCm39) L137* probably null Het
Sufu A G 19: 46,385,675 (GRCm39) Y45C probably damaging Het
Thsd1 C T 8: 22,733,026 (GRCm39) probably benign Het
Tiam2 T A 17: 3,559,706 (GRCm39) L1249Q probably damaging Het
Toe1 C T 4: 116,661,916 (GRCm39) V418M probably benign Het
Trappc12 T C 12: 28,761,985 (GRCm39) probably null Het
Triobp A G 15: 78,858,077 (GRCm39) D1226G probably damaging Het
Zfhx4 T C 3: 5,464,572 (GRCm39) S1602P probably damaging Het
Zfp266 T C 9: 20,410,482 (GRCm39) K565R probably damaging Het
Zfp319 T C 8: 96,055,025 (GRCm39) T393A probably benign Het
Other mutations in Rgs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rgs12 APN 5 35,132,563 (GRCm39) missense probably benign 0.25
IGL02296:Rgs12 APN 5 35,123,464 (GRCm39) missense probably damaging 0.96
IGL02337:Rgs12 APN 5 35,177,697 (GRCm39) missense probably damaging 1.00
IGL02483:Rgs12 APN 5 35,187,861 (GRCm39) missense probably damaging 1.00
IGL02869:Rgs12 APN 5 35,183,227 (GRCm39) missense probably damaging 0.97
IGL02989:Rgs12 APN 5 35,122,463 (GRCm39) missense probably damaging 1.00
R0015:Rgs12 UTSW 5 35,180,120 (GRCm39) unclassified probably benign
R0015:Rgs12 UTSW 5 35,180,120 (GRCm39) unclassified probably benign
R0046:Rgs12 UTSW 5 35,122,664 (GRCm39) missense probably damaging 1.00
R0046:Rgs12 UTSW 5 35,122,664 (GRCm39) missense probably damaging 1.00
R0106:Rgs12 UTSW 5 35,124,008 (GRCm39) missense probably benign 0.03
R0106:Rgs12 UTSW 5 35,124,008 (GRCm39) missense probably benign 0.03
R0233:Rgs12 UTSW 5 35,187,842 (GRCm39) missense probably damaging 1.00
R0233:Rgs12 UTSW 5 35,187,842 (GRCm39) missense probably damaging 1.00
R0245:Rgs12 UTSW 5 35,187,424 (GRCm39) missense probably benign 0.01
R0611:Rgs12 UTSW 5 35,176,804 (GRCm39) missense probably damaging 1.00
R0704:Rgs12 UTSW 5 35,180,466 (GRCm39) missense possibly damaging 0.95
R0723:Rgs12 UTSW 5 35,181,710 (GRCm39) unclassified probably benign
R1174:Rgs12 UTSW 5 35,123,809 (GRCm39) missense probably benign 0.00
R1538:Rgs12 UTSW 5 35,178,511 (GRCm39) missense probably damaging 0.98
R1556:Rgs12 UTSW 5 35,196,626 (GRCm39) missense possibly damaging 0.67
R1774:Rgs12 UTSW 5 35,123,747 (GRCm39) missense probably benign 0.34
R1791:Rgs12 UTSW 5 35,123,456 (GRCm39) missense possibly damaging 0.86
R1866:Rgs12 UTSW 5 35,123,018 (GRCm39) missense probably damaging 1.00
R1872:Rgs12 UTSW 5 35,123,165 (GRCm39) missense probably damaging 1.00
R1923:Rgs12 UTSW 5 35,189,613 (GRCm39) missense probably damaging 1.00
R2012:Rgs12 UTSW 5 35,187,872 (GRCm39) missense probably benign 0.00
R2107:Rgs12 UTSW 5 35,124,079 (GRCm39) missense possibly damaging 0.68
R3730:Rgs12 UTSW 5 35,189,595 (GRCm39) missense probably damaging 1.00
R3731:Rgs12 UTSW 5 35,189,595 (GRCm39) missense probably damaging 1.00
R3808:Rgs12 UTSW 5 35,189,698 (GRCm39) missense probably damaging 1.00
R3826:Rgs12 UTSW 5 35,123,359 (GRCm39) missense possibly damaging 0.94
R3827:Rgs12 UTSW 5 35,123,359 (GRCm39) missense possibly damaging 0.94
R3829:Rgs12 UTSW 5 35,123,359 (GRCm39) missense possibly damaging 0.94
R3830:Rgs12 UTSW 5 35,123,359 (GRCm39) missense possibly damaging 0.94
R4392:Rgs12 UTSW 5 35,189,655 (GRCm39) missense probably damaging 1.00
R4617:Rgs12 UTSW 5 35,177,700 (GRCm39) missense probably damaging 1.00
R5132:Rgs12 UTSW 5 35,147,156 (GRCm39) intron probably benign
R5213:Rgs12 UTSW 5 35,122,664 (GRCm39) missense probably damaging 1.00
R5296:Rgs12 UTSW 5 35,178,448 (GRCm39) unclassified probably benign
R5480:Rgs12 UTSW 5 35,123,455 (GRCm39) missense probably benign 0.09
R5510:Rgs12 UTSW 5 35,123,383 (GRCm39) missense probably damaging 1.00
R5708:Rgs12 UTSW 5 35,123,696 (GRCm39) missense probably benign 0.41
R5987:Rgs12 UTSW 5 35,177,689 (GRCm39) missense probably damaging 1.00
R6053:Rgs12 UTSW 5 35,123,296 (GRCm39) missense probably benign 0.01
R6113:Rgs12 UTSW 5 35,177,667 (GRCm39) missense probably damaging 0.99
R6401:Rgs12 UTSW 5 35,177,676 (GRCm39) missense probably damaging 1.00
R6736:Rgs12 UTSW 5 35,180,436 (GRCm39) missense probably damaging 1.00
R6807:Rgs12 UTSW 5 35,180,515 (GRCm39) missense probably null 0.27
R6857:Rgs12 UTSW 5 35,187,366 (GRCm39) nonsense probably null
R7082:Rgs12 UTSW 5 35,124,050 (GRCm39) missense probably benign 0.00
R7250:Rgs12 UTSW 5 35,122,841 (GRCm39) missense probably damaging 1.00
R7276:Rgs12 UTSW 5 35,183,715 (GRCm39) missense probably benign 0.06
R7444:Rgs12 UTSW 5 35,183,287 (GRCm39) missense possibly damaging 0.65
R7632:Rgs12 UTSW 5 35,122,934 (GRCm39) missense probably damaging 1.00
R8049:Rgs12 UTSW 5 35,183,374 (GRCm39) missense possibly damaging 0.89
R8089:Rgs12 UTSW 5 35,177,692 (GRCm39) missense probably damaging 1.00
R8241:Rgs12 UTSW 5 35,123,117 (GRCm39) missense probably damaging 1.00
R8797:Rgs12 UTSW 5 35,186,915 (GRCm39) missense
R8927:Rgs12 UTSW 5 35,123,633 (GRCm39) missense possibly damaging 0.93
R8928:Rgs12 UTSW 5 35,123,633 (GRCm39) missense possibly damaging 0.93
R9073:Rgs12 UTSW 5 35,177,753 (GRCm39) unclassified probably benign
R9211:Rgs12 UTSW 5 35,123,165 (GRCm39) missense probably damaging 0.98
R9485:Rgs12 UTSW 5 35,189,614 (GRCm39) missense probably damaging 0.99
Z1176:Rgs12 UTSW 5 35,123,113 (GRCm39) missense probably damaging 1.00
Z1177:Rgs12 UTSW 5 35,183,696 (GRCm39) missense probably benign 0.44
Z1177:Rgs12 UTSW 5 35,122,198 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGTGACAGCTTCTCTTC -3'
(R):5'- GGATGAAGTTGTCCCCTCAC -3'

Sequencing Primer
(F):5'- AGCTTCTCTTCTCCCCATGACAG -3'
(R):5'- GATGAAGTTGTCCCCTCACTTCCTAG -3'
Posted On 2022-08-09