Incidental Mutation 'R9550:Sin3a'
ID 720444
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Name transcriptional regulator, SIN3A (yeast)
Synonyms Sin3, mSin3A
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9550 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 56979324-57035650 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56996768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000130221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049169] [ENSMUST00000163400] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678] [ENSMUST00000169879]
AlphaFold Q60520
Predicted Effect probably benign
Transcript: ENSMUST00000049169
AA Change: V99A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163400
SMART Domains Protein: ENSMUSP00000126718
Gene: ENSMUSG00000042557

DomainStartEndE-ValueType
Pfam:PAH 82 128 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167715
AA Change: V99A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168177
AA Change: V99A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168502
AA Change: V99A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168678
AA Change: V99A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169879
AA Change: V99A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 44,022,120 (GRCm39) C457R probably damaging Het
Adamts9 A T 6: 92,878,429 (GRCm39) V546E probably benign Het
Add3 G A 19: 53,233,521 (GRCm39) E641K possibly damaging Het
Anks1b T A 10: 90,412,360 (GRCm39) M1K probably null Het
C1s2 G A 6: 124,605,253 (GRCm39) Q361* probably null Het
Casp4 T C 9: 5,328,465 (GRCm39) S316P probably damaging Het
Cby2 A G 14: 75,820,603 (GRCm39) V374A probably damaging Het
Cdyl A G 13: 36,000,147 (GRCm39) T143A probably benign Het
Cep85 T C 4: 133,858,598 (GRCm39) T760A probably damaging Het
Chd2 A G 7: 73,119,439 (GRCm39) L1035P probably damaging Het
Cpne8 T C 15: 90,453,760 (GRCm39) I208V probably benign Het
Cux1 A G 5: 136,340,387 (GRCm39) L641P probably damaging Het
Dlgap1 T A 17: 71,093,902 (GRCm39) M741K possibly damaging Het
Dnajc16 T C 4: 141,495,058 (GRCm39) Y518C possibly damaging Het
Dtnb A G 12: 3,768,437 (GRCm39) N343D possibly damaging Het
Dusp3 A T 11: 101,872,668 (GRCm39) S43T probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Espn C T 4: 152,215,534 (GRCm39) R575H probably damaging Het
Gls A T 1: 52,251,373 (GRCm39) L328* probably null Het
H2-T23 T C 17: 36,342,712 (GRCm39) D142G probably damaging Het
Hck A G 2: 152,976,651 (GRCm39) M262V probably benign Het
Igkv14-126 G T 6: 67,873,199 (GRCm39) L13F possibly damaging Het
Muc2 C T 7: 141,308,242 (GRCm39) R913C probably damaging Het
Mypop A T 7: 18,726,245 (GRCm39) T71S probably damaging Het
Nadsyn1 A G 7: 143,353,615 (GRCm39) I536T probably damaging Het
Obsl1 T C 1: 75,474,910 (GRCm39) E830G possibly damaging Het
Or1q1 T A 2: 36,887,137 (GRCm39) I105N probably damaging Het
Or8d2b T C 9: 38,788,937 (GRCm39) V155A probably benign Het
Pcdha8 A T 18: 37,127,399 (GRCm39) Y627F possibly damaging Het
Polr1b T A 2: 128,962,205 (GRCm39) S742R unknown Het
Ppm1e A T 11: 87,121,919 (GRCm39) N679K probably benign Het
Raly AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG AGCAGCAGTGGTGGAGG 2: 154,705,754 (GRCm39) probably benign Het
Rgs12 G T 5: 35,196,665 (GRCm39) G1430C probably damaging Het
Rhcg T C 7: 79,248,296 (GRCm39) Y436C probably damaging Het
Ripor3 T C 2: 167,822,807 (GRCm39) D918G probably benign Het
Rlf A G 4: 121,003,620 (GRCm39) F1897L probably damaging Het
Slc22a29 A T 19: 8,195,224 (GRCm39) L137* probably null Het
Sufu A G 19: 46,385,675 (GRCm39) Y45C probably damaging Het
Thsd1 C T 8: 22,733,026 (GRCm39) probably benign Het
Tiam2 T A 17: 3,559,706 (GRCm39) L1249Q probably damaging Het
Toe1 C T 4: 116,661,916 (GRCm39) V418M probably benign Het
Trappc12 T C 12: 28,761,985 (GRCm39) probably null Het
Triobp A G 15: 78,858,077 (GRCm39) D1226G probably damaging Het
Zfhx4 T C 3: 5,464,572 (GRCm39) S1602P probably damaging Het
Zfp266 T C 9: 20,410,482 (GRCm39) K565R probably damaging Het
Zfp319 T C 8: 96,055,025 (GRCm39) T393A probably benign Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57,005,185 (GRCm39) missense probably damaging 1.00
IGL00836:Sin3a APN 9 57,014,629 (GRCm39) splice site probably null
IGL00913:Sin3a APN 9 57,005,402 (GRCm39) missense probably benign 0.01
IGL01721:Sin3a APN 9 57,002,609 (GRCm39) missense probably damaging 1.00
IGL01964:Sin3a APN 9 57,014,631 (GRCm39) splice site probably benign
IGL02333:Sin3a APN 9 57,014,843 (GRCm39) missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57,014,725 (GRCm39) missense probably damaging 0.99
Crumbled UTSW 9 57,017,938 (GRCm39) nonsense probably null
Delicate UTSW 9 57,011,213 (GRCm39) missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57,002,539 (GRCm39) intron probably benign
PIT4519001:Sin3a UTSW 9 57,002,740 (GRCm39) missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57,025,537 (GRCm39) intron probably benign
R0309:Sin3a UTSW 9 57,018,196 (GRCm39) missense probably benign 0.00
R0511:Sin3a UTSW 9 57,004,179 (GRCm39) nonsense probably null
R1205:Sin3a UTSW 9 57,026,459 (GRCm39) missense probably damaging 1.00
R1365:Sin3a UTSW 9 57,032,487 (GRCm39) nonsense probably null
R1496:Sin3a UTSW 9 57,026,442 (GRCm39) missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57,011,281 (GRCm39) splice site probably benign
R1958:Sin3a UTSW 9 57,012,893 (GRCm39) missense probably damaging 1.00
R1993:Sin3a UTSW 9 57,008,483 (GRCm39) missense probably damaging 1.00
R2037:Sin3a UTSW 9 57,004,109 (GRCm39) missense probably benign 0.14
R2065:Sin3a UTSW 9 57,018,084 (GRCm39) missense possibly damaging 0.93
R2079:Sin3a UTSW 9 56,996,807 (GRCm39) missense probably benign
R2193:Sin3a UTSW 9 57,024,761 (GRCm39) missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57,004,118 (GRCm39) nonsense probably null
R3929:Sin3a UTSW 9 57,025,421 (GRCm39) missense probably damaging 0.98
R4326:Sin3a UTSW 9 57,002,642 (GRCm39) missense probably damaging 1.00
R4327:Sin3a UTSW 9 57,002,642 (GRCm39) missense probably damaging 1.00
R4329:Sin3a UTSW 9 57,002,642 (GRCm39) missense probably damaging 1.00
R4765:Sin3a UTSW 9 57,004,087 (GRCm39) missense probably benign 0.14
R4806:Sin3a UTSW 9 56,994,026 (GRCm39) missense probably damaging 0.99
R4979:Sin3a UTSW 9 57,025,360 (GRCm39) missense probably damaging 1.00
R5018:Sin3a UTSW 9 57,018,175 (GRCm39) missense probably benign 0.00
R5368:Sin3a UTSW 9 57,018,084 (GRCm39) missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57,018,272 (GRCm39) missense probably benign 0.10
R5391:Sin3a UTSW 9 57,012,957 (GRCm39) missense probably damaging 1.00
R5395:Sin3a UTSW 9 57,012,957 (GRCm39) missense probably damaging 1.00
R5519:Sin3a UTSW 9 57,025,457 (GRCm39) critical splice donor site probably null
R5927:Sin3a UTSW 9 57,018,395 (GRCm39) missense probably damaging 1.00
R5987:Sin3a UTSW 9 57,034,484 (GRCm39) missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57,014,824 (GRCm39) missense probably damaging 1.00
R6161:Sin3a UTSW 9 57,002,708 (GRCm39) missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57,011,213 (GRCm39) missense probably damaging 1.00
R6374:Sin3a UTSW 9 57,024,765 (GRCm39) missense probably benign
R6456:Sin3a UTSW 9 57,020,985 (GRCm39) missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57,024,824 (GRCm39) missense probably benign 0.02
R6900:Sin3a UTSW 9 57,014,858 (GRCm39) missense probably damaging 1.00
R7051:Sin3a UTSW 9 57,011,218 (GRCm39) missense probably damaging 1.00
R7081:Sin3a UTSW 9 57,001,755 (GRCm39) missense probably null 1.00
R7285:Sin3a UTSW 9 57,034,583 (GRCm39) missense possibly damaging 0.57
R7462:Sin3a UTSW 9 57,002,809 (GRCm39) missense probably benign 0.00
R7538:Sin3a UTSW 9 57,011,210 (GRCm39) missense possibly damaging 0.95
R7699:Sin3a UTSW 9 57,017,938 (GRCm39) nonsense probably null
R8150:Sin3a UTSW 9 57,034,568 (GRCm39) missense possibly damaging 0.92
R8158:Sin3a UTSW 9 57,020,828 (GRCm39) critical splice acceptor site probably null
R8717:Sin3a UTSW 9 57,034,510 (GRCm39) missense probably damaging 0.99
R9048:Sin3a UTSW 9 57,032,620 (GRCm39) missense probably damaging 0.99
R9283:Sin3a UTSW 9 57,002,717 (GRCm39) missense probably damaging 0.99
R9300:Sin3a UTSW 9 57,014,744 (GRCm39) missense probably damaging 1.00
R9330:Sin3a UTSW 9 57,032,481 (GRCm39) missense probably damaging 1.00
R9396:Sin3a UTSW 9 57,008,445 (GRCm39) missense probably benign 0.28
R9746:Sin3a UTSW 9 57,025,358 (GRCm39) missense probably benign 0.11
RF017:Sin3a UTSW 9 57,034,610 (GRCm39) missense possibly damaging 0.90
X0026:Sin3a UTSW 9 57,032,476 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTAGATGCATTTGGGAGAG -3'
(R):5'- AATGTATGTTCCTCTGGATCAGG -3'

Sequencing Primer
(F):5'- GAGAATGCAACAAGCCTTAGTTTGTC -3'
(R):5'- GGGAAATACATGCAAGTTTCAAAAC -3'
Posted On 2022-08-09