Incidental Mutation 'R9550:Dlgap1'
ID 720456
Institutional Source Beutler Lab
Gene Symbol Dlgap1
Ensembl Gene ENSMUSG00000003279
Gene Name DLG associated protein 1
Synonyms Sapap1, Gkap, GKAP/SAPAP, SAPAP1, D17Bwg0511e, DAP-1 beta, 4933422O14Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9550 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 70276068-71128408 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71093902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 741 (M741K)
Ref Sequence ENSEMBL: ENSMUSP00000122896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060072] [ENSMUST00000097288] [ENSMUST00000133717] [ENSMUST00000133983] [ENSMUST00000135938] [ENSMUST00000140728] [ENSMUST00000155016] [ENSMUST00000146730] [ENSMUST00000148486]
AlphaFold Q9D415
Predicted Effect
SMART Domains Protein: ENSMUSP00000052858
Gene: ENSMUSG00000003279
AA Change: M731K

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097288
AA Change: M433K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000094890
Gene: ENSMUSG00000003279
AA Change: M433K

DomainStartEndE-ValueType
low complexity region 208 228 N/A INTRINSIC
low complexity region 244 261 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:GKAP 345 625 9.4e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133717
AA Change: M415K

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122370
Gene: ENSMUSG00000003279
AA Change: M415K

DomainStartEndE-ValueType
low complexity region 218 238 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
Pfam:GKAP 327 666 1.3e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133983
AA Change: M731K

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116716
Gene: ENSMUSG00000003279
AA Change: M731K

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 515 539 N/A INTRINSIC
low complexity region 542 559 N/A INTRINSIC
low complexity region 628 642 N/A INTRINSIC
Pfam:GKAP 643 982 6.8e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135938
AA Change: M713K

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118497
Gene: ENSMUSG00000003279
AA Change: M713K

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 610 624 N/A INTRINSIC
Pfam:GKAP 625 964 9.3e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140728
AA Change: M441K

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117358
Gene: ENSMUSG00000003279
AA Change: M441K

DomainStartEndE-ValueType
low complexity region 216 236 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Pfam:GKAP 353 692 1.4e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000155016
AA Change: M741K

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122896
Gene: ENSMUSG00000003279
AA Change: M741K

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 660 992 2e-153 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146730
AA Change: M741K

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116072
Gene: ENSMUSG00000003279
AA Change: M741K

DomainStartEndE-ValueType
low complexity region 180 210 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
low complexity region 552 569 N/A INTRINSIC
low complexity region 638 652 N/A INTRINSIC
Pfam:GKAP 653 933 9.5e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148486
AA Change: M431K

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122337
Gene: ENSMUSG00000003279
AA Change: M431K

DomainStartEndE-ValueType
low complexity region 215 239 N/A INTRINSIC
low complexity region 242 259 N/A INTRINSIC
low complexity region 328 342 N/A INTRINSIC
Pfam:GKAP 343 682 1.3e-139 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A G 8: 44,022,120 (GRCm39) C457R probably damaging Het
Adamts9 A T 6: 92,878,429 (GRCm39) V546E probably benign Het
Add3 G A 19: 53,233,521 (GRCm39) E641K possibly damaging Het
Anks1b T A 10: 90,412,360 (GRCm39) M1K probably null Het
C1s2 G A 6: 124,605,253 (GRCm39) Q361* probably null Het
Casp4 T C 9: 5,328,465 (GRCm39) S316P probably damaging Het
Cby2 A G 14: 75,820,603 (GRCm39) V374A probably damaging Het
Cdyl A G 13: 36,000,147 (GRCm39) T143A probably benign Het
Cep85 T C 4: 133,858,598 (GRCm39) T760A probably damaging Het
Chd2 A G 7: 73,119,439 (GRCm39) L1035P probably damaging Het
Cpne8 T C 15: 90,453,760 (GRCm39) I208V probably benign Het
Cux1 A G 5: 136,340,387 (GRCm39) L641P probably damaging Het
Dnajc16 T C 4: 141,495,058 (GRCm39) Y518C possibly damaging Het
Dtnb A G 12: 3,768,437 (GRCm39) N343D possibly damaging Het
Dusp3 A T 11: 101,872,668 (GRCm39) S43T probably benign Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Espn C T 4: 152,215,534 (GRCm39) R575H probably damaging Het
Gls A T 1: 52,251,373 (GRCm39) L328* probably null Het
H2-T23 T C 17: 36,342,712 (GRCm39) D142G probably damaging Het
Hck A G 2: 152,976,651 (GRCm39) M262V probably benign Het
Igkv14-126 G T 6: 67,873,199 (GRCm39) L13F possibly damaging Het
Muc2 C T 7: 141,308,242 (GRCm39) R913C probably damaging Het
Mypop A T 7: 18,726,245 (GRCm39) T71S probably damaging Het
Nadsyn1 A G 7: 143,353,615 (GRCm39) I536T probably damaging Het
Obsl1 T C 1: 75,474,910 (GRCm39) E830G possibly damaging Het
Or1q1 T A 2: 36,887,137 (GRCm39) I105N probably damaging Het
Or8d2b T C 9: 38,788,937 (GRCm39) V155A probably benign Het
Pcdha8 A T 18: 37,127,399 (GRCm39) Y627F possibly damaging Het
Polr1b T A 2: 128,962,205 (GRCm39) S742R unknown Het
Ppm1e A T 11: 87,121,919 (GRCm39) N679K probably benign Het
Raly AGCAGCAGTGGTGGAGGAGGAGGCAGCAGTGGTGGAGG AGCAGCAGTGGTGGAGG 2: 154,705,754 (GRCm39) probably benign Het
Rgs12 G T 5: 35,196,665 (GRCm39) G1430C probably damaging Het
Rhcg T C 7: 79,248,296 (GRCm39) Y436C probably damaging Het
Ripor3 T C 2: 167,822,807 (GRCm39) D918G probably benign Het
Rlf A G 4: 121,003,620 (GRCm39) F1897L probably damaging Het
Sin3a T C 9: 56,996,768 (GRCm39) V99A probably benign Het
Slc22a29 A T 19: 8,195,224 (GRCm39) L137* probably null Het
Sufu A G 19: 46,385,675 (GRCm39) Y45C probably damaging Het
Thsd1 C T 8: 22,733,026 (GRCm39) probably benign Het
Tiam2 T A 17: 3,559,706 (GRCm39) L1249Q probably damaging Het
Toe1 C T 4: 116,661,916 (GRCm39) V418M probably benign Het
Trappc12 T C 12: 28,761,985 (GRCm39) probably null Het
Triobp A G 15: 78,858,077 (GRCm39) D1226G probably damaging Het
Zfhx4 T C 3: 5,464,572 (GRCm39) S1602P probably damaging Het
Zfp266 T C 9: 20,410,482 (GRCm39) K565R probably damaging Het
Zfp319 T C 8: 96,055,025 (GRCm39) T393A probably benign Het
Other mutations in Dlgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dlgap1 APN 17 70,823,080 (GRCm39) missense probably benign 0.02
IGL01413:Dlgap1 APN 17 70,823,069 (GRCm39) missense probably benign 0.00
IGL01531:Dlgap1 APN 17 70,823,374 (GRCm39) missense probably damaging 1.00
IGL02226:Dlgap1 APN 17 70,823,029 (GRCm39) missense probably damaging 1.00
BB009:Dlgap1 UTSW 17 70,823,233 (GRCm39) missense probably damaging 1.00
BB019:Dlgap1 UTSW 17 70,823,233 (GRCm39) missense probably damaging 1.00
R0453:Dlgap1 UTSW 17 71,068,341 (GRCm39) missense probably benign 0.03
R0482:Dlgap1 UTSW 17 70,823,185 (GRCm39) missense probably benign 0.11
R0520:Dlgap1 UTSW 17 70,823,989 (GRCm39) nonsense probably null
R1951:Dlgap1 UTSW 17 71,068,306 (GRCm39) missense probably damaging 0.96
R2072:Dlgap1 UTSW 17 70,969,765 (GRCm39) missense probably damaging 0.99
R2076:Dlgap1 UTSW 17 71,093,826 (GRCm39) nonsense probably null
R3438:Dlgap1 UTSW 17 70,823,356 (GRCm39) missense probably damaging 0.97
R3743:Dlgap1 UTSW 17 71,025,221 (GRCm39) critical splice donor site probably null
R3881:Dlgap1 UTSW 17 71,093,810 (GRCm39) missense probably damaging 1.00
R3981:Dlgap1 UTSW 17 70,823,780 (GRCm39) missense probably damaging 1.00
R4043:Dlgap1 UTSW 17 71,068,075 (GRCm39) missense probably damaging 1.00
R4272:Dlgap1 UTSW 17 71,073,038 (GRCm39) missense probably benign
R4273:Dlgap1 UTSW 17 71,073,038 (GRCm39) missense probably benign
R4557:Dlgap1 UTSW 17 70,823,684 (GRCm39) missense probably benign 0.01
R4652:Dlgap1 UTSW 17 71,068,090 (GRCm39) missense probably damaging 1.00
R4771:Dlgap1 UTSW 17 70,900,375 (GRCm39) nonsense probably null
R5000:Dlgap1 UTSW 17 71,073,053 (GRCm39) missense probably damaging 1.00
R5004:Dlgap1 UTSW 17 71,025,222 (GRCm39) critical splice donor site probably null
R5291:Dlgap1 UTSW 17 71,025,205 (GRCm39) missense probably benign 0.03
R5304:Dlgap1 UTSW 17 71,122,202 (GRCm39) missense probably damaging 1.00
R5473:Dlgap1 UTSW 17 70,824,025 (GRCm39) intron probably benign
R5522:Dlgap1 UTSW 17 70,823,993 (GRCm39) critical splice donor site probably null
R5586:Dlgap1 UTSW 17 71,125,156 (GRCm39) missense probably damaging 1.00
R5742:Dlgap1 UTSW 17 71,025,194 (GRCm39) missense probably benign
R5802:Dlgap1 UTSW 17 71,073,086 (GRCm39) critical splice donor site probably null
R5850:Dlgap1 UTSW 17 71,094,087 (GRCm39) missense probably damaging 1.00
R5857:Dlgap1 UTSW 17 71,122,388 (GRCm39) intron probably benign
R5883:Dlgap1 UTSW 17 70,824,008 (GRCm39) intron probably benign
R6045:Dlgap1 UTSW 17 71,125,093 (GRCm39) missense probably damaging 1.00
R6336:Dlgap1 UTSW 17 71,122,284 (GRCm39) missense probably damaging 1.00
R6448:Dlgap1 UTSW 17 70,900,325 (GRCm39) missense possibly damaging 0.59
R6682:Dlgap1 UTSW 17 71,094,118 (GRCm39) missense probably damaging 1.00
R6795:Dlgap1 UTSW 17 71,125,069 (GRCm39) missense possibly damaging 0.48
R7147:Dlgap1 UTSW 17 70,969,753 (GRCm39) missense probably benign 0.00
R7187:Dlgap1 UTSW 17 70,823,093 (GRCm39) missense possibly damaging 0.93
R7382:Dlgap1 UTSW 17 71,094,169 (GRCm39) missense probably damaging 1.00
R7859:Dlgap1 UTSW 17 70,823,683 (GRCm39) missense probably benign
R7932:Dlgap1 UTSW 17 70,823,233 (GRCm39) missense probably damaging 1.00
R8477:Dlgap1 UTSW 17 70,823,967 (GRCm39) missense probably damaging 1.00
R8673:Dlgap1 UTSW 17 71,122,293 (GRCm39) missense probably damaging 1.00
R8866:Dlgap1 UTSW 17 70,823,435 (GRCm39) missense probably damaging 1.00
R8910:Dlgap1 UTSW 17 71,093,815 (GRCm39) missense probably damaging 1.00
R8997:Dlgap1 UTSW 17 70,823,528 (GRCm39) missense possibly damaging 0.63
R9012:Dlgap1 UTSW 17 70,823,182 (GRCm39) missense possibly damaging 0.94
R9035:Dlgap1 UTSW 17 70,823,855 (GRCm39) missense possibly damaging 0.73
R9067:Dlgap1 UTSW 17 71,116,186 (GRCm39) missense probably damaging 1.00
R9361:Dlgap1 UTSW 17 71,068,259 (GRCm39) missense probably damaging 1.00
R9464:Dlgap1 UTSW 17 70,823,964 (GRCm39) missense probably benign 0.11
R9564:Dlgap1 UTSW 17 70,964,458 (GRCm39) missense probably benign 0.02
R9565:Dlgap1 UTSW 17 70,964,458 (GRCm39) missense probably benign 0.02
T0975:Dlgap1 UTSW 17 70,823,950 (GRCm39) missense possibly damaging 0.86
Z1176:Dlgap1 UTSW 17 71,122,204 (GRCm39) missense probably damaging 1.00
Z1177:Dlgap1 UTSW 17 70,969,738 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAGGCCCCAATAAATACCCTG -3'
(R):5'- TCTGCCTGGAGAAGCTTCAG -3'

Sequencing Primer
(F):5'- ACCCTGAAACTGAATCTCATTTCTC -3'
(R):5'- TGGCACACGGACCTTTGAAC -3'
Posted On 2022-08-09