Incidental Mutation 'R9551:Erbb4'
ID 720462
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Name erb-b2 receptor tyrosine kinase 4
Synonyms Her4, ErbB4
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9551 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 68071345-69147218 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 68779642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 45 (Q45*)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
AlphaFold Q61527
Predicted Effect probably null
Transcript: ENSMUST00000119142
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: Q45*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121473
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: Q45*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153432
AA Change: Q45*
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: Q45*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Birc6 T A 17: 74,916,064 (GRCm39) L1660Q probably benign Het
Blvrb A G 7: 27,158,786 (GRCm39) D62G probably benign Het
Ccdc68 T A 18: 70,089,113 (GRCm39) S219T probably damaging Het
Cep120 C A 18: 53,819,033 (GRCm39) R886L possibly damaging Het
Cep290 T C 10: 100,372,729 (GRCm39) S1176P probably damaging Het
Cnbp A G 6: 87,822,108 (GRCm39) Y139H probably damaging Het
Csmd3 T A 15: 48,655,356 (GRCm39) probably benign Het
Cyp2c66 T C 19: 39,172,246 (GRCm39) V387A probably damaging Het
Dab2ip T A 2: 35,605,330 (GRCm39) C504S possibly damaging Het
Depdc7 C T 2: 104,553,220 (GRCm39) probably null Het
Edrf1 A G 7: 133,240,742 (GRCm39) D73G probably damaging Het
Elp3 T C 14: 65,797,634 (GRCm39) I365V probably benign Het
Fam124a T G 14: 62,843,988 (GRCm39) S499A possibly damaging Het
Has2 T C 15: 56,531,090 (GRCm39) K542E probably benign Het
Hnrnpk A G 13: 58,544,058 (GRCm39) S116P probably benign Het
Hs3st6 T C 17: 24,977,228 (GRCm39) L236P probably damaging Het
Il15 T A 8: 83,061,177 (GRCm39) H100L probably benign Het
Kif14 C A 1: 136,455,219 (GRCm39) S1630R probably damaging Het
Madd T C 2: 91,000,434 (GRCm39) T544A probably damaging Het
Mamdc4 T C 2: 25,460,035 (GRCm39) D76G probably damaging Het
Mark2 G T 19: 7,263,263 (GRCm39) T201N possibly damaging Het
Mfsd9 T C 1: 40,813,152 (GRCm39) T388A probably damaging Het
Mgst3 T C 1: 167,205,871 (GRCm39) Y36C probably damaging Het
Myh11 T A 16: 14,064,673 (GRCm39) E215V Het
Nmd3 T C 3: 69,647,329 (GRCm39) V277A possibly damaging Het
Or11g1 C T 14: 50,651,625 (GRCm39) S208F probably benign Het
Or2y14 C T 11: 49,404,942 (GRCm39) T159I probably damaging Het
Or6k4 A T 1: 173,964,885 (GRCm39) T192S probably benign Het
Pbx1 T C 1: 168,258,910 (GRCm39) D55G possibly damaging Het
Pdzrn3 T C 6: 101,127,855 (GRCm39) D937G probably damaging Het
Phb1 G A 11: 95,562,257 (GRCm39) V45I probably benign Het
Pi4ka T C 16: 17,125,574 (GRCm39) E1187G Het
Piezo2 T C 18: 63,166,033 (GRCm39) E2066G possibly damaging Het
Pkn2 T C 3: 142,499,594 (GRCm39) D977G probably damaging Het
Polr1b C T 2: 128,957,684 (GRCm39) R580* probably null Het
Pyroxd2 A G 19: 42,719,756 (GRCm39) probably null Het
Rpain T C 11: 70,865,816 (GRCm39) S194P probably damaging Het
Scaf1 A G 7: 44,658,351 (GRCm39) L176P probably damaging Het
Scgb1b12 C A 7: 32,033,974 (GRCm39) A78E probably benign Het
Scgb2b19 A G 7: 32,979,198 (GRCm39) F28S probably damaging Het
Setx T C 2: 29,020,244 (GRCm39) M77T possibly damaging Het
Skint5 C T 4: 113,798,052 (GRCm39) C177Y possibly damaging Het
Slco6c1 T C 1: 97,055,827 (GRCm39) S25G probably benign Het
Sorbs1 G A 19: 40,361,923 (GRCm39) R154* probably null Het
Ssb T A 2: 69,696,982 (GRCm39) D107E probably benign Het
Tcerg1l T C 7: 137,995,998 (GRCm39) D170G possibly damaging Het
Tle5 T C 10: 81,399,988 (GRCm39) V62A probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmco4 G A 4: 138,779,895 (GRCm39) V447M probably damaging Het
Trf C T 9: 103,099,283 (GRCm39) V339I probably benign Het
Ucp1 T C 8: 84,024,509 (GRCm39) L278P probably damaging Het
Vmn1r82 A G 7: 12,039,600 (GRCm39) N291S possibly damaging Het
Vmn1r86 A T 7: 12,836,781 (GRCm39) Y32N possibly damaging Het
Wnt10b C A 15: 98,670,713 (GRCm39) G272W probably damaging Het
Xpo4 A G 14: 57,828,512 (GRCm39) F783L possibly damaging Het
Yipf4 T C 17: 74,806,024 (GRCm39) F221S probably damaging Het
Zfp1005 C A 2: 150,109,856 (GRCm39) T182K unknown Het
Zfp512 G A 5: 31,623,676 (GRCm39) C14Y probably benign Het
Zfp595 A T 13: 67,465,067 (GRCm39) S402T probably damaging Het
Zfp658 G T 7: 43,222,567 (GRCm39) V281F probably benign Het
Zfp827 T G 8: 79,787,403 (GRCm39) W190G probably damaging Het
Zpld2 G A 4: 133,929,312 (GRCm39) P331L probably benign Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68,110,789 (GRCm39) nonsense probably null
IGL01020:Erbb4 APN 1 68,337,608 (GRCm39) splice site probably benign
IGL01349:Erbb4 APN 1 68,385,752 (GRCm39) missense probably benign 0.00
IGL01386:Erbb4 APN 1 68,383,090 (GRCm39) missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68,367,404 (GRCm39) nonsense probably null
IGL01536:Erbb4 APN 1 68,329,441 (GRCm39) missense probably benign 0.00
IGL01721:Erbb4 APN 1 68,293,722 (GRCm39) missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68,293,725 (GRCm39) missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68,119,885 (GRCm39) missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68,081,694 (GRCm39) missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68,329,453 (GRCm39) missense probably benign 0.00
IGL02399:Erbb4 APN 1 68,081,596 (GRCm39) splice site probably benign
IGL02553:Erbb4 APN 1 68,345,023 (GRCm39) missense probably benign 0.17
IGL03118:Erbb4 APN 1 68,081,878 (GRCm39) missense probably benign 0.11
IGL03329:Erbb4 APN 1 68,367,281 (GRCm39) missense probably benign 0.30
IGL03405:Erbb4 APN 1 68,369,397 (GRCm39) missense probably benign 0.02
earthworm UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
excrescence UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
Mole UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68,110,835 (GRCm39) missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68,114,702 (GRCm39) missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68,083,119 (GRCm39) intron probably benign
R0329:Erbb4 UTSW 1 68,337,439 (GRCm39) splice site probably benign
R0335:Erbb4 UTSW 1 68,298,418 (GRCm39) missense probably benign
R0362:Erbb4 UTSW 1 68,369,429 (GRCm39) missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68,081,621 (GRCm39) missense probably benign 0.17
R0730:Erbb4 UTSW 1 68,298,449 (GRCm39) missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68,348,773 (GRCm39) missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68,293,759 (GRCm39) missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68,385,705 (GRCm39) missense probably benign 0.00
R1523:Erbb4 UTSW 1 68,435,411 (GRCm39) missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68,117,741 (GRCm39) nonsense probably null
R1604:Erbb4 UTSW 1 68,385,728 (GRCm39) missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68,079,547 (GRCm39) missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68,370,393 (GRCm39) missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68,114,569 (GRCm39) splice site probably benign
R1929:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68,337,482 (GRCm39) missense probably benign 0.02
R2139:Erbb4 UTSW 1 68,385,788 (GRCm39) missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68,081,690 (GRCm39) missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68,117,755 (GRCm39) missense probably benign 0.00
R3821:Erbb4 UTSW 1 68,345,072 (GRCm39) missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68,779,560 (GRCm39) missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68,079,496 (GRCm39) missense probably benign 0.07
R4196:Erbb4 UTSW 1 68,383,014 (GRCm39) missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68,385,781 (GRCm39) missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68,383,080 (GRCm39) nonsense probably null
R4642:Erbb4 UTSW 1 68,289,791 (GRCm39) missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68,337,473 (GRCm39) missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68,293,703 (GRCm39) missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68,369,397 (GRCm39) missense probably benign 0.02
R5068:Erbb4 UTSW 1 68,083,061 (GRCm39) splice site probably null
R5546:Erbb4 UTSW 1 68,337,452 (GRCm39) missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68,599,678 (GRCm39) missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68,083,075 (GRCm39) missense probably benign
R6257:Erbb4 UTSW 1 68,435,432 (GRCm39) missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68,081,689 (GRCm39) missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68,409,662 (GRCm39) missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68,079,462 (GRCm39) missense probably benign 0.00
R7087:Erbb4 UTSW 1 68,779,650 (GRCm39) missense probably null 1.00
R7215:Erbb4 UTSW 1 68,378,619 (GRCm39) missense probably benign
R7356:Erbb4 UTSW 1 68,378,514 (GRCm39) critical splice donor site probably null
R7509:Erbb4 UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68,293,758 (GRCm39) missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68,367,278 (GRCm39) missense probably benign 0.00
R7784:Erbb4 UTSW 1 68,114,658 (GRCm39) missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68,081,885 (GRCm39) missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68,298,368 (GRCm39) missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68,435,470 (GRCm39) missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68,337,509 (GRCm39) missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68,348,785 (GRCm39) missense probably benign
R8783:Erbb4 UTSW 1 68,079,331 (GRCm39) missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68,114,627 (GRCm39) missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68,382,997 (GRCm39) critical splice donor site probably null
R9053:Erbb4 UTSW 1 68,289,779 (GRCm39) missense possibly damaging 0.63
R9142:Erbb4 UTSW 1 68,388,552 (GRCm39) missense probably damaging 1.00
R9237:Erbb4 UTSW 1 68,081,601 (GRCm39) missense possibly damaging 0.72
R9350:Erbb4 UTSW 1 68,329,638 (GRCm39) missense probably benign 0.00
R9374:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9434:Erbb4 UTSW 1 68,081,773 (GRCm39) missense possibly damaging 0.84
R9499:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9753:Erbb4 UTSW 1 68,238,062 (GRCm39) missense probably benign 0.00
X0019:Erbb4 UTSW 1 68,112,304 (GRCm39) missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68,367,418 (GRCm39) nonsense probably null
Z1176:Erbb4 UTSW 1 68,337,561 (GRCm39) frame shift probably null
Z1177:Erbb4 UTSW 1 68,348,802 (GRCm39) missense probably benign 0.06
Z1177:Erbb4 UTSW 1 68,329,635 (GRCm39) missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68,298,342 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTCCTGCCCACAGTCATAG -3'
(R):5'- GTGGTCTATGACGCTCAATCAC -3'

Sequencing Primer
(F):5'- GAGCTACCAGGTCTAGTCAAGC -3'
(R):5'- GGTCTATGACGCTCAATCACATTTG -3'
Posted On 2022-08-09