Mutagenetix > Incidental Mutation

Incidental Mutation 'R9551:Cep120'

720518

Institutional Source

Beutler Lab

Gene Symbol

Cep120

Ensembl Gene

ENSMUSG00000048799

Gene Name

centrosomal protein 120

Synonyms

Ccdc100

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R9551 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53681724-53744547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 53685961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 886 (R886L)

Ref Sequence

ENSEMBL: ENSMUSP00000062433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049811]

AlphaFold

Q7TSG1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049811
AA Change: R886L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: R886L

Domain	Start	End	E-Value	Type
Pfam:C2	9	114	4.8e-5	PFAM
Pfam:DUF3668	118	340	1e-96	PFAM
low complexity region	378	396	N/A	INTRINSIC
Pfam:C2	520	568	1.9e-3	PFAM
low complexity region	632	642	N/A	INTRINSIC
SCOP:d1eq1a_	661	803	2e-4	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
Aes	T	C	10: 81,564,154	V62A	probably damaging	Het
Birc6	T	A	17: 74,609,069	L1660Q	probably benign	Het
Blvrb	A	G	7: 27,459,361	D62G	probably benign	Het
Ccdc68	T	A	18: 69,956,042	S219T	probably damaging	Het
Cep290	T	C	10: 100,536,867	S1176P	probably damaging	Het
Cnbp	A	G	6: 87,845,126	Y139H	probably damaging	Het
Csmd3	T	A	15: 48,791,960		probably benign	Het
Cyp2c66	T	C	19: 39,183,802	V387A	probably damaging	Het
Dab2ip	T	A	2: 35,715,318	C504S	possibly damaging	Het
Depdc7	C	T	2: 104,722,875		probably null	Het
Edrf1	A	G	7: 133,639,013	D73G	probably damaging	Het
Elp3	T	C	14: 65,560,185	I365V	probably benign	Het
Erbb4	G	A	1: 68,740,483	Q45*	probably null	Het
Fam124a	T	G	14: 62,606,539	S499A	possibly damaging	Het
Gm14124	C	A	2: 150,267,936	T182K	unknown	Het
Gm7534	G	A	4: 134,202,001	P331L	probably benign	Het
Has2	T	C	15: 56,667,694	K542E	probably benign	Het
Hnrnpk	A	G	13: 58,396,244	S116P	probably benign	Het
Hs3st6	T	C	17: 24,758,254	L236P	probably damaging	Het
Il15	T	A	8: 82,334,548	H100L	probably benign	Het
Kif14	C	A	1: 136,527,481	S1630R	probably damaging	Het
Madd	T	C	2: 91,170,089	T544A	probably damaging	Het
Mamdc4	T	C	2: 25,570,023	D76G	probably damaging	Het
Mark2	G	T	19: 7,285,898	T201N	possibly damaging	Het
Mfsd9	T	C	1: 40,773,992	T388A	probably damaging	Het
Mgst3	T	C	1: 167,378,302	Y36C	probably damaging	Het
Myh11	T	A	16: 14,246,809	E215V		Het
Nmd3	T	C	3: 69,739,996	V277A	possibly damaging	Het
Olfr1384	C	T	11: 49,514,115	T159I	probably damaging	Het
Olfr424	A	T	1: 174,137,319	T192S	probably benign	Het
Olfr738	C	T	14: 50,414,168	S208F	probably benign	Het
Pbx1	T	C	1: 168,431,341	D55G	possibly damaging	Het
Pdzrn3	T	C	6: 101,150,894	D937G	probably damaging	Het
Phb	G	A	11: 95,671,431	V45I	probably benign	Het
Pi4ka	T	C	16: 17,307,710	E1187G		Het
Piezo2	T	C	18: 63,032,962	E2066G	possibly damaging	Het
Pkn2	T	C	3: 142,793,833	D977G	probably damaging	Het
Polr1b	C	T	2: 129,115,764	R580*	probably null	Het
Pyroxd2	A	G	19: 42,731,317		probably null	Het
Rpain	T	C	11: 70,974,990	S194P	probably damaging	Het
Scaf1	A	G	7: 45,008,927	L176P	probably damaging	Het
Scgb1b12	C	A	7: 32,334,549	A78E	probably benign	Het
Scgb2b19	A	G	7: 33,279,773	F28S	probably damaging	Het
Setx	T	C	2: 29,130,232	M77T	possibly damaging	Het
Skint5	C	T	4: 113,940,855	C177Y	possibly damaging	Het
Slco6c1	T	C	1: 97,128,102	S25G	probably benign	Het
Sorbs1	G	A	19: 40,373,479	R154*	probably null	Het
Ssb	T	A	2: 69,866,638	D107E	probably benign	Het
Tcerg1l	T	C	7: 138,394,269	D170G	possibly damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmco4	G	A	4: 139,052,584	V447M	probably damaging	Het
Trf	C	T	9: 103,222,084	V339I	probably benign	Het
Ucp1	T	C	8: 83,297,880	L278P	probably damaging	Het
Vmn1r82	A	G	7: 12,305,673	N291S	possibly damaging	Het
Vmn1r86	A	T	7: 13,102,854	Y32N	possibly damaging	Het
Wnt10b	C	A	15: 98,772,832	G272W	probably damaging	Het
Xpo4	A	G	14: 57,591,055	F783L	possibly damaging	Het
Yipf4	T	C	17: 74,499,029	F221S	probably damaging	Het
Zfp512	G	A	5: 31,466,332	C14Y	probably benign	Het
Zfp595	A	T	13: 67,317,003	S402T	probably damaging	Het
Zfp658	G	T	7: 43,573,143	V281F	probably benign	Het
Zfp827	T	G	8: 79,060,774	W190G	probably damaging	Het

Other mutations in Cep120

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01544:Cep120	APN	18	53685961	missense	probably benign	0.24
IGL01774:Cep120	APN	18	53706830	missense	possibly damaging	0.92
IGL01862:Cep120	APN	18	53714767	missense	probably benign	0.01
IGL01906:Cep120	APN	18	53714912	missense	probably benign
IGL01941:Cep120	APN	18	53723148	missense	probably benign	0.00
IGL02952:Cep120	APN	18	53683228	utr 3 prime	probably benign
IGL03248:Cep120	APN	18	53735772	missense	probably benign	0.04
IGL03379:Cep120	APN	18	53709136	missense	probably benign
R0019:Cep120	UTSW	18	53709047	splice site	probably benign
R0039:Cep120	UTSW	18	53685961	missense	probably benign	0.24
R0763:Cep120	UTSW	18	53721737	missense	probably benign	0.00
R1015:Cep120	UTSW	18	53703121	critical splice donor site	probably null
R1340:Cep120	UTSW	18	53724391	missense	probably damaging	1.00
R1507:Cep120	UTSW	18	53697657	missense	probably damaging	0.99
R1649:Cep120	UTSW	18	53724576	missense	probably damaging	1.00
R1727:Cep120	UTSW	18	53727729	missense	probably benign	0.01
R1739:Cep120	UTSW	18	53719214	critical splice donor site	probably null
R1873:Cep120	UTSW	18	53738488	missense	probably damaging	0.98
R1913:Cep120	UTSW	18	53723286	missense	probably benign	0.26
R1968:Cep120	UTSW	18	53723241	missense	probably benign	0.42
R1995:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2042:Cep120	UTSW	18	53735742	missense	possibly damaging	0.50
R2074:Cep120	UTSW	18	53719312	missense	possibly damaging	0.83
R2116:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2215:Cep120	UTSW	18	53727635	missense	probably damaging	1.00
R2697:Cep120	UTSW	18	53740125	missense	probably benign	0.00
R3813:Cep120	UTSW	18	53740212	splice site	probably benign
R4012:Cep120	UTSW	18	53738582	missense	probably damaging	0.99
R4368:Cep120	UTSW	18	53685885	splice site	probably null
R4615:Cep120	UTSW	18	53714841	missense	probably damaging	1.00
R4772:Cep120	UTSW	18	53718489	missense	probably damaging	1.00
R4780:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R5195:Cep120	UTSW	18	53721698	missense	probably damaging	1.00
R5991:Cep120	UTSW	18	53721798	missense	probably benign
R6156:Cep120	UTSW	18	53703223	missense	probably benign	0.00
R6188:Cep120	UTSW	18	53724457	missense	probably benign	0.03
R6688:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R6961:Cep120	UTSW	18	53703205	nonsense	probably null
R7143:Cep120	UTSW	18	53683385	missense	probably benign	0.00
R7282:Cep120	UTSW	18	53740089	missense	probably damaging	1.00
R7813:Cep120	UTSW	18	53738506	missense	probably damaging	1.00
R7818:Cep120	UTSW	18	53723103	missense	probably benign
R8677:Cep120	UTSW	18	53738561	missense	possibly damaging	0.90
R8724:Cep120	UTSW	18	53723127	missense	possibly damaging	0.88
R9164:Cep120	UTSW	18	53719246	missense	probably benign	0.02
R9225:Cep120	UTSW	18	53706824	missense	probably benign	0.00
R9300:Cep120	UTSW	18	53719297	missense	probably damaging	0.99
R9312:Cep120	UTSW	18	53727641	missense	probably benign	0.08
R9377:Cep120	UTSW	18	53718520	missense	possibly damaging	0.66
R9390:Cep120	UTSW	18	53706912	nonsense	probably null
R9499:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GCAACTCATTCAGTAAGACTGG -3'
(R):5'- TTCATTGGGTCCAGAATTGGC -3'

Sequencing Primer
(F):5'- GAGAAAGACTTCGCCACCTTGG -3'
(R):5'- GTCCAGAATTGGCAGCATTTC -3'

Posted On

2022-08-09