Incidental Mutation 'R9551:Cep120'
ID 720518
Institutional Source Beutler Lab
Gene Symbol Cep120
Ensembl Gene ENSMUSG00000048799
Gene Name centrosomal protein 120
Synonyms Ccdc100
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.773) question?
Stock # R9551 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 53814795-53877680 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 53819033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 886 (R886L)
Ref Sequence ENSEMBL: ENSMUSP00000062433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049811]
AlphaFold Q7TSG1
Predicted Effect possibly damaging
Transcript: ENSMUST00000049811
AA Change: R886L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: R886L

DomainStartEndE-ValueType
Pfam:C2 9 114 4.8e-5 PFAM
Pfam:DUF3668 118 340 1e-96 PFAM
low complexity region 378 396 N/A INTRINSIC
Pfam:C2 520 568 1.9e-3 PFAM
low complexity region 632 642 N/A INTRINSIC
SCOP:d1eq1a_ 661 803 2e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Birc6 T A 17: 74,916,064 (GRCm39) L1660Q probably benign Het
Blvrb A G 7: 27,158,786 (GRCm39) D62G probably benign Het
Ccdc68 T A 18: 70,089,113 (GRCm39) S219T probably damaging Het
Cep290 T C 10: 100,372,729 (GRCm39) S1176P probably damaging Het
Cnbp A G 6: 87,822,108 (GRCm39) Y139H probably damaging Het
Csmd3 T A 15: 48,655,356 (GRCm39) probably benign Het
Cyp2c66 T C 19: 39,172,246 (GRCm39) V387A probably damaging Het
Dab2ip T A 2: 35,605,330 (GRCm39) C504S possibly damaging Het
Depdc7 C T 2: 104,553,220 (GRCm39) probably null Het
Edrf1 A G 7: 133,240,742 (GRCm39) D73G probably damaging Het
Elp3 T C 14: 65,797,634 (GRCm39) I365V probably benign Het
Erbb4 G A 1: 68,779,642 (GRCm39) Q45* probably null Het
Fam124a T G 14: 62,843,988 (GRCm39) S499A possibly damaging Het
Has2 T C 15: 56,531,090 (GRCm39) K542E probably benign Het
Hnrnpk A G 13: 58,544,058 (GRCm39) S116P probably benign Het
Hs3st6 T C 17: 24,977,228 (GRCm39) L236P probably damaging Het
Il15 T A 8: 83,061,177 (GRCm39) H100L probably benign Het
Kif14 C A 1: 136,455,219 (GRCm39) S1630R probably damaging Het
Madd T C 2: 91,000,434 (GRCm39) T544A probably damaging Het
Mamdc4 T C 2: 25,460,035 (GRCm39) D76G probably damaging Het
Mark2 G T 19: 7,263,263 (GRCm39) T201N possibly damaging Het
Mfsd9 T C 1: 40,813,152 (GRCm39) T388A probably damaging Het
Mgst3 T C 1: 167,205,871 (GRCm39) Y36C probably damaging Het
Myh11 T A 16: 14,064,673 (GRCm39) E215V Het
Nmd3 T C 3: 69,647,329 (GRCm39) V277A possibly damaging Het
Or11g1 C T 14: 50,651,625 (GRCm39) S208F probably benign Het
Or2y14 C T 11: 49,404,942 (GRCm39) T159I probably damaging Het
Or6k4 A T 1: 173,964,885 (GRCm39) T192S probably benign Het
Pbx1 T C 1: 168,258,910 (GRCm39) D55G possibly damaging Het
Pdzrn3 T C 6: 101,127,855 (GRCm39) D937G probably damaging Het
Phb1 G A 11: 95,562,257 (GRCm39) V45I probably benign Het
Pi4ka T C 16: 17,125,574 (GRCm39) E1187G Het
Piezo2 T C 18: 63,166,033 (GRCm39) E2066G possibly damaging Het
Pkn2 T C 3: 142,499,594 (GRCm39) D977G probably damaging Het
Polr1b C T 2: 128,957,684 (GRCm39) R580* probably null Het
Pyroxd2 A G 19: 42,719,756 (GRCm39) probably null Het
Rpain T C 11: 70,865,816 (GRCm39) S194P probably damaging Het
Scaf1 A G 7: 44,658,351 (GRCm39) L176P probably damaging Het
Scgb1b12 C A 7: 32,033,974 (GRCm39) A78E probably benign Het
Scgb2b19 A G 7: 32,979,198 (GRCm39) F28S probably damaging Het
Setx T C 2: 29,020,244 (GRCm39) M77T possibly damaging Het
Skint5 C T 4: 113,798,052 (GRCm39) C177Y possibly damaging Het
Slco6c1 T C 1: 97,055,827 (GRCm39) S25G probably benign Het
Sorbs1 G A 19: 40,361,923 (GRCm39) R154* probably null Het
Ssb T A 2: 69,696,982 (GRCm39) D107E probably benign Het
Tcerg1l T C 7: 137,995,998 (GRCm39) D170G possibly damaging Het
Tle5 T C 10: 81,399,988 (GRCm39) V62A probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmco4 G A 4: 138,779,895 (GRCm39) V447M probably damaging Het
Trf C T 9: 103,099,283 (GRCm39) V339I probably benign Het
Ucp1 T C 8: 84,024,509 (GRCm39) L278P probably damaging Het
Vmn1r82 A G 7: 12,039,600 (GRCm39) N291S possibly damaging Het
Vmn1r86 A T 7: 12,836,781 (GRCm39) Y32N possibly damaging Het
Wnt10b C A 15: 98,670,713 (GRCm39) G272W probably damaging Het
Xpo4 A G 14: 57,828,512 (GRCm39) F783L possibly damaging Het
Yipf4 T C 17: 74,806,024 (GRCm39) F221S probably damaging Het
Zfp1005 C A 2: 150,109,856 (GRCm39) T182K unknown Het
Zfp512 G A 5: 31,623,676 (GRCm39) C14Y probably benign Het
Zfp595 A T 13: 67,465,067 (GRCm39) S402T probably damaging Het
Zfp658 G T 7: 43,222,567 (GRCm39) V281F probably benign Het
Zfp827 T G 8: 79,787,403 (GRCm39) W190G probably damaging Het
Zpld2 G A 4: 133,929,312 (GRCm39) P331L probably benign Het
Other mutations in Cep120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Cep120 APN 18 53,819,033 (GRCm39) missense probably benign 0.24
IGL01774:Cep120 APN 18 53,839,902 (GRCm39) missense possibly damaging 0.92
IGL01862:Cep120 APN 18 53,847,839 (GRCm39) missense probably benign 0.01
IGL01906:Cep120 APN 18 53,847,984 (GRCm39) missense probably benign
IGL01941:Cep120 APN 18 53,856,220 (GRCm39) missense probably benign 0.00
IGL02952:Cep120 APN 18 53,816,300 (GRCm39) utr 3 prime probably benign
IGL03248:Cep120 APN 18 53,868,844 (GRCm39) missense probably benign 0.04
IGL03379:Cep120 APN 18 53,842,208 (GRCm39) missense probably benign
R0019:Cep120 UTSW 18 53,842,119 (GRCm39) splice site probably benign
R0039:Cep120 UTSW 18 53,819,033 (GRCm39) missense probably benign 0.24
R0763:Cep120 UTSW 18 53,854,809 (GRCm39) missense probably benign 0.00
R1015:Cep120 UTSW 18 53,836,193 (GRCm39) critical splice donor site probably null
R1340:Cep120 UTSW 18 53,857,463 (GRCm39) missense probably damaging 1.00
R1507:Cep120 UTSW 18 53,830,729 (GRCm39) missense probably damaging 0.99
R1649:Cep120 UTSW 18 53,857,648 (GRCm39) missense probably damaging 1.00
R1727:Cep120 UTSW 18 53,860,801 (GRCm39) missense probably benign 0.01
R1739:Cep120 UTSW 18 53,852,286 (GRCm39) critical splice donor site probably null
R1873:Cep120 UTSW 18 53,871,560 (GRCm39) missense probably damaging 0.98
R1913:Cep120 UTSW 18 53,856,358 (GRCm39) missense probably benign 0.26
R1968:Cep120 UTSW 18 53,856,313 (GRCm39) missense probably benign 0.42
R1995:Cep120 UTSW 18 53,873,208 (GRCm39) missense probably damaging 1.00
R2042:Cep120 UTSW 18 53,868,814 (GRCm39) missense possibly damaging 0.50
R2074:Cep120 UTSW 18 53,852,384 (GRCm39) missense possibly damaging 0.83
R2116:Cep120 UTSW 18 53,873,208 (GRCm39) missense probably damaging 1.00
R2215:Cep120 UTSW 18 53,860,707 (GRCm39) missense probably damaging 1.00
R2697:Cep120 UTSW 18 53,873,197 (GRCm39) missense probably benign 0.00
R3813:Cep120 UTSW 18 53,873,284 (GRCm39) splice site probably benign
R4012:Cep120 UTSW 18 53,871,654 (GRCm39) missense probably damaging 0.99
R4368:Cep120 UTSW 18 53,818,957 (GRCm39) splice site probably null
R4615:Cep120 UTSW 18 53,847,913 (GRCm39) missense probably damaging 1.00
R4772:Cep120 UTSW 18 53,851,561 (GRCm39) missense probably damaging 1.00
R4780:Cep120 UTSW 18 53,857,608 (GRCm39) missense probably benign 0.12
R5195:Cep120 UTSW 18 53,854,770 (GRCm39) missense probably damaging 1.00
R5991:Cep120 UTSW 18 53,854,870 (GRCm39) missense probably benign
R6156:Cep120 UTSW 18 53,836,295 (GRCm39) missense probably benign 0.00
R6188:Cep120 UTSW 18 53,857,529 (GRCm39) missense probably benign 0.03
R6688:Cep120 UTSW 18 53,857,608 (GRCm39) missense probably benign 0.12
R6961:Cep120 UTSW 18 53,836,277 (GRCm39) nonsense probably null
R7143:Cep120 UTSW 18 53,816,457 (GRCm39) missense probably benign 0.00
R7282:Cep120 UTSW 18 53,873,161 (GRCm39) missense probably damaging 1.00
R7813:Cep120 UTSW 18 53,871,578 (GRCm39) missense probably damaging 1.00
R7818:Cep120 UTSW 18 53,856,175 (GRCm39) missense probably benign
R8677:Cep120 UTSW 18 53,871,633 (GRCm39) missense possibly damaging 0.90
R8724:Cep120 UTSW 18 53,856,199 (GRCm39) missense possibly damaging 0.88
R9164:Cep120 UTSW 18 53,852,318 (GRCm39) missense probably benign 0.02
R9225:Cep120 UTSW 18 53,839,896 (GRCm39) missense probably benign 0.00
R9300:Cep120 UTSW 18 53,852,369 (GRCm39) missense probably damaging 0.99
R9312:Cep120 UTSW 18 53,860,713 (GRCm39) missense probably benign 0.08
R9377:Cep120 UTSW 18 53,851,592 (GRCm39) missense possibly damaging 0.66
R9390:Cep120 UTSW 18 53,839,984 (GRCm39) nonsense probably null
R9499:Cep120 UTSW 18 53,819,033 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCAACTCATTCAGTAAGACTGG -3'
(R):5'- TTCATTGGGTCCAGAATTGGC -3'

Sequencing Primer
(F):5'- GAGAAAGACTTCGCCACCTTGG -3'
(R):5'- GTCCAGAATTGGCAGCATTTC -3'
Posted On 2022-08-09