Mutagenetix > Incidental Mutation

Incidental Mutation 'R9551:Piezo2'

720519

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9551 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63032962 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2066 (E2066G)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047480]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047480
AA Change: E2066G

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: E2066G

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137141

SMART Domains

Protein: ENSMUSP00000117107
Gene: ENSMUSG00000041482

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
transmembrane domain	84	106	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	235	409	4.6e-78	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623 (GRCm38)		probably benign	Het
Birc6	T	A	17: 74,609,069 (GRCm38)	L1660Q	probably benign	Het
Blvrb	A	G	7: 27,459,361 (GRCm38)	D62G	probably benign	Het
Ccdc68	T	A	18: 69,956,042 (GRCm38)	S219T	probably damaging	Het
Cep120	C	A	18: 53,685,961 (GRCm38)	R886L	possibly damaging	Het
Cep290	T	C	10: 100,536,867 (GRCm38)	S1176P	probably damaging	Het
Cnbp	A	G	6: 87,845,126 (GRCm38)	Y139H	probably damaging	Het
Csmd3	T	A	15: 48,791,960 (GRCm38)		probably benign	Het
Cyp2c66	T	C	19: 39,183,802 (GRCm38)	V387A	probably damaging	Het
Dab2ip	T	A	2: 35,715,318 (GRCm38)	C504S	possibly damaging	Het
Depdc7	C	T	2: 104,722,875 (GRCm38)		probably null	Het
Edrf1	A	G	7: 133,639,013 (GRCm38)	D73G	probably damaging	Het
Elp3	T	C	14: 65,560,185 (GRCm38)	I365V	probably benign	Het
Erbb4	G	A	1: 68,740,483 (GRCm38)	Q45*	probably null	Het
Fam124a	T	G	14: 62,606,539 (GRCm38)	S499A	possibly damaging	Het
Has2	T	C	15: 56,667,694 (GRCm38)	K542E	probably benign	Het
Hnrnpk	A	G	13: 58,396,244 (GRCm38)	S116P	probably benign	Het
Hs3st6	T	C	17: 24,758,254 (GRCm38)	L236P	probably damaging	Het
Il15	T	A	8: 82,334,548 (GRCm38)	H100L	probably benign	Het
Kif14	C	A	1: 136,527,481 (GRCm38)	S1630R	probably damaging	Het
Madd	T	C	2: 91,170,089 (GRCm38)	T544A	probably damaging	Het
Mamdc4	T	C	2: 25,570,023 (GRCm38)	D76G	probably damaging	Het
Mark2	G	T	19: 7,285,898 (GRCm38)	T201N	possibly damaging	Het
Mfsd9	T	C	1: 40,773,992 (GRCm38)	T388A	probably damaging	Het
Mgst3	T	C	1: 167,378,302 (GRCm38)	Y36C	probably damaging	Het
Myh11	T	A	16: 14,246,809 (GRCm38)	E215V		Het
Nmd3	T	C	3: 69,739,996 (GRCm38)	V277A	possibly damaging	Het
Or11g1	C	T	14: 50,414,168 (GRCm38)	S208F	probably benign	Het
Or2y14	C	T	11: 49,514,115 (GRCm38)	T159I	probably damaging	Het
Or6k4	A	T	1: 174,137,319 (GRCm38)	T192S	probably benign	Het
Pbx1	T	C	1: 168,431,341 (GRCm38)	D55G	possibly damaging	Het
Pdzrn3	T	C	6: 101,150,894 (GRCm38)	D937G	probably damaging	Het
Phb1	G	A	11: 95,671,431 (GRCm38)	V45I	probably benign	Het
Pi4ka	T	C	16: 17,307,710 (GRCm38)	E1187G		Het
Pkn2	T	C	3: 142,793,833 (GRCm38)	D977G	probably damaging	Het
Polr1b	C	T	2: 129,115,764 (GRCm38)	R580*	probably null	Het
Pyroxd2	A	G	19: 42,731,317 (GRCm38)		probably null	Het
Rpain	T	C	11: 70,974,990 (GRCm38)	S194P	probably damaging	Het
Scaf1	A	G	7: 45,008,927 (GRCm38)	L176P	probably damaging	Het
Scgb1b12	C	A	7: 32,334,549 (GRCm38)	A78E	probably benign	Het
Scgb2b19	A	G	7: 33,279,773 (GRCm38)	F28S	probably damaging	Het
Setx	T	C	2: 29,130,232 (GRCm38)	M77T	possibly damaging	Het
Skint5	C	T	4: 113,940,855 (GRCm38)	C177Y	possibly damaging	Het
Slco6c1	T	C	1: 97,128,102 (GRCm38)	S25G	probably benign	Het
Sorbs1	G	A	19: 40,373,479 (GRCm38)	R154*	probably null	Het
Ssb	T	A	2: 69,866,638 (GRCm38)	D107E	probably benign	Het
Tcerg1l	T	C	7: 138,394,269 (GRCm38)	D170G	possibly damaging	Het
Tle5	T	C	10: 81,564,154 (GRCm38)	V62A	probably damaging	Het
Tm7sf3	C	T	6: 146,623,681 (GRCm38)	D89N	possibly damaging	Het
Tmco4	G	A	4: 139,052,584 (GRCm38)	V447M	probably damaging	Het
Trf	C	T	9: 103,222,084 (GRCm38)	V339I	probably benign	Het
Ucp1	T	C	8: 83,297,880 (GRCm38)	L278P	probably damaging	Het
Vmn1r82	A	G	7: 12,305,673 (GRCm38)	N291S	possibly damaging	Het
Vmn1r86	A	T	7: 13,102,854 (GRCm38)	Y32N	possibly damaging	Het
Wnt10b	C	A	15: 98,772,832 (GRCm38)	G272W	probably damaging	Het
Xpo4	A	G	14: 57,591,055 (GRCm38)	F783L	possibly damaging	Het
Yipf4	T	C	17: 74,499,029 (GRCm38)	F221S	probably damaging	Het
Zfp1005	C	A	2: 150,267,936 (GRCm38)	T182K	unknown	Het
Zfp512	G	A	5: 31,466,332 (GRCm38)	C14Y	probably benign	Het
Zfp595	A	T	13: 67,317,003 (GRCm38)	S402T	probably damaging	Het
Zfp658	G	T	7: 43,573,143 (GRCm38)	V281F	probably benign	Het
Zfp827	T	G	8: 79,060,774 (GRCm38)	W190G	probably damaging	Het
Zpld2	G	A	4: 134,202,001 (GRCm38)	P331L	probably benign	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63,117,699 (GRCm38)	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63,022,460 (GRCm38)	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63,070,030 (GRCm38)	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63,124,614 (GRCm38)	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63,030,392 (GRCm38)	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63,182,833 (GRCm38)	splice site	probably benign
IGL01674:Piezo2	APN	18	63,027,559 (GRCm38)	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63,083,170 (GRCm38)	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63,042,788 (GRCm38)	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63,092,844 (GRCm38)	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63,020,634 (GRCm38)	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63,146,844 (GRCm38)	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63,072,862 (GRCm38)	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63,032,924 (GRCm38)	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63,024,475 (GRCm38)	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63,074,659 (GRCm38)	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63,020,633 (GRCm38)	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63,064,785 (GRCm38)	splice site	probably benign
IGL03011:Piezo2	APN	18	63,124,660 (GRCm38)	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63,070,075 (GRCm38)	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63,030,272 (GRCm38)	splice site	probably null
IGL03129:Piezo2	APN	18	63,114,972 (GRCm38)	missense	probably benign
IGL03143:Piezo2	APN	18	63,108,076 (GRCm38)	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63,011,598 (GRCm38)	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63,124,606 (GRCm38)	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63,053,062 (GRCm38)	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63,041,720 (GRCm38)	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63,011,538 (GRCm38)	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63,021,308 (GRCm38)	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63,027,704 (GRCm38)	missense	probably damaging	1.00
Piccolo	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
sopranino	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
woodwind	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63,386,200 (GRCm38)	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63,024,469 (GRCm38)	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63,102,084 (GRCm38)	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63,024,491 (GRCm38)	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63,029,061 (GRCm38)	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63,102,174 (GRCm38)	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63,024,451 (GRCm38)	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63,027,544 (GRCm38)	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63,022,481 (GRCm38)	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63,022,426 (GRCm38)	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63,019,258 (GRCm38)	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63,041,723 (GRCm38)	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63,083,235 (GRCm38)	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63,015,802 (GRCm38)	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63,086,753 (GRCm38)	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63,021,254 (GRCm38)	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63,083,131 (GRCm38)	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63,144,919 (GRCm38)	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63,082,915 (GRCm38)	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63,117,672 (GRCm38)	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63,021,173 (GRCm38)	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63,124,642 (GRCm38)	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63,106,284 (GRCm38)	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63,108,087 (GRCm38)	missense	probably damaging	1.00
R1799:Piezo2	UTSW	18	63,032,840 (GRCm38)	critical splice donor site	probably null
R1868:Piezo2	UTSW	18	63,019,344 (GRCm38)	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63,113,960 (GRCm38)	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63,078,840 (GRCm38)	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63,074,662 (GRCm38)	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63,078,781 (GRCm38)	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63,144,926 (GRCm38)	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63,059,744 (GRCm38)	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63,118,935 (GRCm38)	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63,081,734 (GRCm38)	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63,117,720 (GRCm38)	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63,114,041 (GRCm38)	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63,106,274 (GRCm38)	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63,145,072 (GRCm38)	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63,022,525 (GRCm38)	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63,245,624 (GRCm38)	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63,053,035 (GRCm38)	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63,146,843 (GRCm38)	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63,024,435 (GRCm38)	nonsense	probably null
R3016:Piezo2	UTSW	18	63,042,832 (GRCm38)	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63,081,793 (GRCm38)	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63,081,662 (GRCm38)	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63,011,696 (GRCm38)	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63,050,604 (GRCm38)	missense	probably benign
R4181:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63,084,840 (GRCm38)	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63,124,730 (GRCm38)	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63,102,099 (GRCm38)	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63,114,063 (GRCm38)	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63,072,880 (GRCm38)	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63,086,628 (GRCm38)	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63,069,963 (GRCm38)	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63,030,401 (GRCm38)	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63,144,954 (GRCm38)	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63,078,791 (GRCm38)	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63,157,262 (GRCm38)	missense	probably benign
R4961:Piezo2	UTSW	18	63,052,961 (GRCm38)	splice site	probably null
R4968:Piezo2	UTSW	18	63,144,971 (GRCm38)	nonsense	probably null
R4973:Piezo2	UTSW	18	63,074,680 (GRCm38)	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63,083,113 (GRCm38)	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63,024,536 (GRCm38)	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63,074,620 (GRCm38)	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63,030,409 (GRCm38)	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63,032,929 (GRCm38)	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63,064,731 (GRCm38)	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63,084,740 (GRCm38)	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63,145,105 (GRCm38)	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63,027,864 (GRCm38)	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63,011,721 (GRCm38)	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63,145,091 (GRCm38)	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63,117,697 (GRCm38)	missense	probably benign	0.25
R5677:Piezo2	UTSW	18	63,117,696 (GRCm38)	missense	possibly damaging	0.94
R5792:Piezo2	UTSW	18	63,146,856 (GRCm38)	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63,027,901 (GRCm38)	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63,113,934 (GRCm38)	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6036:Piezo2	UTSW	18	63,114,948 (GRCm38)	nonsense	probably null
R6073:Piezo2	UTSW	18	63,012,645 (GRCm38)	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63,157,210 (GRCm38)	nonsense	probably null
R6255:Piezo2	UTSW	18	63,121,270 (GRCm38)	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63,117,678 (GRCm38)	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63,106,293 (GRCm38)	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63,086,607 (GRCm38)	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63,041,663 (GRCm38)	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63,106,271 (GRCm38)	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63,021,328 (GRCm38)	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63,021,262 (GRCm38)	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63,032,889 (GRCm38)	nonsense	probably null
R6855:Piezo2	UTSW	18	63,090,879 (GRCm38)	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63,032,986 (GRCm38)	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63,082,961 (GRCm38)	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63,145,110 (GRCm38)	nonsense	probably null
R7162:Piezo2	UTSW	18	63,124,709 (GRCm38)	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63,108,030 (GRCm38)	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63,017,519 (GRCm38)	splice site	probably null
R7395:Piezo2	UTSW	18	63,027,563 (GRCm38)	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63,024,472 (GRCm38)	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63,012,723 (GRCm38)	missense	probably benign
R7517:Piezo2	UTSW	18	63,082,925 (GRCm38)	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63,053,010 (GRCm38)	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63,042,539 (GRCm38)	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63,113,876 (GRCm38)	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63,082,945 (GRCm38)	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63,083,200 (GRCm38)	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63,042,811 (GRCm38)	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63,030,466 (GRCm38)	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63,075,730 (GRCm38)	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63,012,786 (GRCm38)	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63,084,688 (GRCm38)	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63,090,998 (GRCm38)	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63,045,540 (GRCm38)	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63,146,802 (GRCm38)	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63,092,900 (GRCm38)	nonsense	probably null
R8708:Piezo2	UTSW	18	63,093,015 (GRCm38)	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8727:Piezo2	UTSW	18	63,109,885 (GRCm38)	missense	probably benign
R8810:Piezo2	UTSW	18	63,114,963 (GRCm38)	missense	probably benign	0.41
R8900:Piezo2	UTSW	18	63,115,025 (GRCm38)	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63,092,831 (GRCm38)	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63,024,466 (GRCm38)	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63,045,518 (GRCm38)	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63,045,479 (GRCm38)	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63,117,744 (GRCm38)	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63,157,231 (GRCm38)	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63,021,301 (GRCm38)	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63,075,797 (GRCm38)	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63,030,379 (GRCm38)	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63,075,719 (GRCm38)	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63,024,566 (GRCm38)	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63,029,085 (GRCm38)	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63,032,962 (GRCm38)	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63,102,165 (GRCm38)	missense	possibly damaging	0.95
R9607:Piezo2	UTSW	18	63,386,276 (GRCm38)	start gained	probably benign
R9608:Piezo2	UTSW	18	63,146,945 (GRCm38)	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63,115,037 (GRCm38)	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63,064,696 (GRCm38)	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63,027,586 (GRCm38)	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63,050,610 (GRCm38)	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63,017,577 (GRCm38)	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63,069,994 (GRCm38)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTGAACTTCTAACACGGGG -3'
(R):5'- AACCCAGGAGCTCTGAGATC -3'

Sequencing Primer
(F):5'- CTTCTAACACGGGGGCAATG -3'
(R):5'- CCAGGAGCTCTGAGATCATTAC -3'

Posted On

2022-08-09