Incidental Mutation 'R9553:Dnah7b'
ID 720588
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Name dynein, axonemal, heavy chain 7B
Synonyms LOC227058, Dnahc7b
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R9553 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 46105475-46412710 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46264956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 2150 (Y2150C)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000069293
AA Change: Y2150C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: Y2150C

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik C T 7: 43,900,334 (GRCm39) R80W probably damaging Het
Ankdd1b G T 13: 96,591,294 (GRCm39) N68K possibly damaging Het
Arhgef1 A G 7: 24,619,115 (GRCm39) E452G probably damaging Het
Cbx8 T G 11: 118,930,964 (GRCm39) E45D probably damaging Het
Ceacam15 T C 7: 16,407,316 (GRCm39) Y67C probably damaging Het
Ceacam20 A G 7: 19,723,926 (GRCm39) Y570C probably damaging Het
Cnga4 A G 7: 105,054,977 (GRCm39) Y187C probably damaging Het
Cntrob T C 11: 69,205,679 (GRCm39) N385S probably benign Het
Coro7 A G 16: 4,486,624 (GRCm39) V183A possibly damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
E2f8 A G 7: 48,528,394 (GRCm39) S25P probably damaging Het
Eif1ad7 A G 12: 88,238,476 (GRCm39) Y95H probably damaging Het
Eif3d T C 15: 77,843,837 (GRCm39) E503G probably damaging Het
Elp6 T A 9: 110,144,965 (GRCm39) V157D probably damaging Het
Entpd3 T C 9: 120,387,546 (GRCm39) Y248H probably damaging Het
Fam186a T C 15: 99,844,561 (GRCm39) E561G unknown Het
Fbxl13 C T 5: 21,728,151 (GRCm39) G519S probably damaging Het
Fgfr4 T G 13: 55,309,228 (GRCm39) S422A probably damaging Het
Flg2 G A 3: 93,121,901 (GRCm39) C1357Y unknown Het
Fpr3 T A 17: 18,191,612 (GRCm39) N294K probably damaging Het
Gas6 T C 8: 13,525,048 (GRCm39) Q312R possibly damaging Het
Glg1 C T 8: 111,926,770 (GRCm39) E182K probably benign Het
Gucy1b1 T C 3: 81,947,087 (GRCm39) D374G probably damaging Het
Ifrd2 C T 9: 107,468,285 (GRCm39) T251I possibly damaging Het
Igkv4-91 C T 6: 68,745,632 (GRCm39) G89R possibly damaging Het
Kcnk1 C A 8: 126,756,322 (GRCm39) Y281* probably null Het
Kcp G T 6: 29,485,100 (GRCm39) F1217L probably null Het
Lama3 G A 18: 12,563,019 (GRCm39) G514D probably damaging Het
Madd A G 2: 91,008,800 (GRCm39) L34P probably damaging Het
Mak T A 13: 41,183,595 (GRCm39) T562S probably benign Het
Nfatc4 A G 14: 56,070,259 (GRCm39) E879G probably damaging Het
Or5w14 A T 2: 87,541,992 (GRCm39) V86E probably benign Het
Pcdhb19 C T 18: 37,631,848 (GRCm39) R548C probably damaging Het
Peli2 A G 14: 48,488,150 (GRCm39) I165V probably damaging Het
Plekhd1 A T 12: 80,753,977 (GRCm39) M148L probably benign Het
Rars2 G A 4: 34,637,014 (GRCm39) G172R probably damaging Het
Reck T C 4: 43,928,310 (GRCm39) V537A probably damaging Het
Rnf135 T A 11: 80,074,758 (GRCm39) S6T probably benign Het
Sirpb1a C T 3: 15,476,320 (GRCm39) C226Y probably damaging Het
Speg A C 1: 75,394,645 (GRCm39) I1785L probably benign Het
Spry4 T C 18: 38,723,070 (GRCm39) N231S probably damaging Het
Tchh C T 3: 93,355,125 (GRCm39) Q1522* probably null Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Trav7d-3 G T 14: 52,981,820 (GRCm39) probably benign Het
Vmn2r49 A C 7: 9,720,849 (GRCm39) V214G probably benign Het
Vmn2r80 T C 10: 78,984,743 (GRCm39) Y32H probably benign Het
Vwf A C 6: 125,577,662 (GRCm39) D501A Het
Zfp428 A G 7: 24,214,866 (GRCm39) T161A possibly damaging Het
Zpld2 G A 4: 133,929,312 (GRCm39) P331L probably benign Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46,181,309 (GRCm39) missense probably benign 0.04
IGL00796:Dnah7b APN 1 46,250,497 (GRCm39) missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46,263,811 (GRCm39) missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46,105,889 (GRCm39) unclassified probably benign
IGL00950:Dnah7b APN 1 46,253,482 (GRCm39) missense probably benign 0.07
IGL01142:Dnah7b APN 1 46,234,538 (GRCm39) critical splice donor site probably null
IGL01350:Dnah7b APN 1 46,120,592 (GRCm39) splice site probably benign
IGL01392:Dnah7b APN 1 46,165,948 (GRCm39) missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46,155,460 (GRCm39) splice site probably benign
IGL01460:Dnah7b APN 1 46,178,864 (GRCm39) missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46,307,813 (GRCm39) missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46,397,307 (GRCm39) missense probably benign 0.29
IGL01838:Dnah7b APN 1 46,397,297 (GRCm39) nonsense probably null
IGL01906:Dnah7b APN 1 46,214,613 (GRCm39) missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46,163,497 (GRCm39) splice site probably benign
IGL01989:Dnah7b APN 1 46,328,694 (GRCm39) missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46,179,035 (GRCm39) missense probably benign
IGL02213:Dnah7b APN 1 46,272,752 (GRCm39) missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46,266,090 (GRCm39) missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46,138,663 (GRCm39) nonsense probably null
IGL02381:Dnah7b APN 1 46,316,280 (GRCm39) missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46,273,353 (GRCm39) missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46,234,478 (GRCm39) missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46,162,937 (GRCm39) missense probably benign 0.02
IGL02655:Dnah7b APN 1 46,155,461 (GRCm39) splice site probably benign
IGL02704:Dnah7b APN 1 46,181,293 (GRCm39) missense probably benign 0.03
IGL02719:Dnah7b APN 1 46,138,768 (GRCm39) splice site probably benign
IGL02745:Dnah7b APN 1 46,234,189 (GRCm39) splice site probably benign
IGL02818:Dnah7b APN 1 46,329,968 (GRCm39) missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46,158,458 (GRCm39) missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46,221,535 (GRCm39) missense probably benign 0.00
IGL03354:Dnah7b APN 1 46,124,849 (GRCm39) missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46,158,464 (GRCm39) missense probably benign 0.18
BB001:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
BB011:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46,412,508 (GRCm39) missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46,252,520 (GRCm39) missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46,262,338 (GRCm39) missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46,258,508 (GRCm39) missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46,162,937 (GRCm39) missense probably benign 0.26
R0313:Dnah7b UTSW 1 46,246,803 (GRCm39) missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46,173,816 (GRCm39) missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46,280,104 (GRCm39) missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46,316,286 (GRCm39) missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46,275,948 (GRCm39) missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46,179,336 (GRCm39) missense probably benign 0.00
R0502:Dnah7b UTSW 1 46,258,704 (GRCm39) missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46,280,152 (GRCm39) missense probably benign 0.02
R0664:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46,379,292 (GRCm39) missense probably benign 0.00
R0931:Dnah7b UTSW 1 46,138,772 (GRCm39) splice site probably benign
R1035:Dnah7b UTSW 1 46,163,608 (GRCm39) missense probably benign
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46,364,970 (GRCm39) missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46,379,280 (GRCm39) missense probably benign 0.00
R1318:Dnah7b UTSW 1 46,138,669 (GRCm39) missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46,328,816 (GRCm39) missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46,117,753 (GRCm39) splice site probably benign
R1484:Dnah7b UTSW 1 46,176,703 (GRCm39) missense probably benign 0.00
R1529:Dnah7b UTSW 1 46,216,441 (GRCm39) missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46,105,957 (GRCm39) missense unknown
R1607:Dnah7b UTSW 1 46,329,806 (GRCm39) missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46,392,126 (GRCm39) missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46,214,550 (GRCm39) nonsense probably null
R1681:Dnah7b UTSW 1 46,363,872 (GRCm39) nonsense probably null
R1716:Dnah7b UTSW 1 46,230,943 (GRCm39) missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46,272,919 (GRCm39) missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46,316,265 (GRCm39) missense probably damaging 1.00
R1838:Dnah7b UTSW 1 46,155,337 (GRCm39) missense probably benign 0.04
R1898:Dnah7b UTSW 1 46,275,874 (GRCm39) missense probably benign 0.02
R1962:Dnah7b UTSW 1 46,281,263 (GRCm39) missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46,181,247 (GRCm39) missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46,281,481 (GRCm39) nonsense probably null
R2083:Dnah7b UTSW 1 46,280,227 (GRCm39) missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46,137,152 (GRCm39) splice site probably benign
R2172:Dnah7b UTSW 1 46,163,672 (GRCm39) missense probably benign 0.12
R2239:Dnah7b UTSW 1 46,240,344 (GRCm39) splice site probably benign
R2247:Dnah7b UTSW 1 46,316,223 (GRCm39) missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46,273,075 (GRCm39) missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46,402,114 (GRCm39) missense probably benign 0.31
R2509:Dnah7b UTSW 1 46,234,447 (GRCm39) missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46,178,901 (GRCm39) missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46,246,732 (GRCm39) missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46,227,847 (GRCm39) critical splice donor site probably null
R3022:Dnah7b UTSW 1 46,221,583 (GRCm39) missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46,307,869 (GRCm39) missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46,392,033 (GRCm39) missense probably benign 0.00
R3735:Dnah7b UTSW 1 46,339,035 (GRCm39) missense probably benign 0.05
R3898:Dnah7b UTSW 1 46,282,417 (GRCm39) missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46,176,645 (GRCm39) missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46,272,871 (GRCm39) missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46,120,655 (GRCm39) missense probably benign
R4172:Dnah7b UTSW 1 46,266,106 (GRCm39) missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46,176,578 (GRCm39) missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46,260,932 (GRCm39) missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
R4414:Dnah7b UTSW 1 46,165,840 (GRCm39) missense probably benign 0.00
R4495:Dnah7b UTSW 1 46,124,792 (GRCm39) missense probably benign 0.00
R4660:Dnah7b UTSW 1 46,328,696 (GRCm39) missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46,117,684 (GRCm39) missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46,256,317 (GRCm39) missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46,250,488 (GRCm39) missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46,246,816 (GRCm39) missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46,106,115 (GRCm39) missense unknown
R4780:Dnah7b UTSW 1 46,392,174 (GRCm39) missense probably benign
R4828:Dnah7b UTSW 1 46,167,272 (GRCm39) missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46,395,762 (GRCm39) missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46,234,234 (GRCm39) missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46,120,604 (GRCm39) missense probably benign 0.21
R4881:Dnah7b UTSW 1 46,240,478 (GRCm39) missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46,329,935 (GRCm39) missense probably benign 0.04
R4960:Dnah7b UTSW 1 46,272,886 (GRCm39) missense probably benign
R5000:Dnah7b UTSW 1 46,138,663 (GRCm39) nonsense probably null
R5005:Dnah7b UTSW 1 46,281,188 (GRCm39) missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46,226,523 (GRCm39) missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46,221,540 (GRCm39) nonsense probably null
R5174:Dnah7b UTSW 1 46,282,509 (GRCm39) missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46,397,376 (GRCm39) missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46,273,018 (GRCm39) missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46,412,514 (GRCm39) missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46,272,849 (GRCm39) missense probably benign 0.16
R5380:Dnah7b UTSW 1 46,256,351 (GRCm39) missense probably benign 0.18
R5387:Dnah7b UTSW 1 46,227,819 (GRCm39) missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46,397,431 (GRCm39) missense probably benign 0.01
R5426:Dnah7b UTSW 1 46,281,366 (GRCm39) missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46,281,179 (GRCm39) missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46,148,472 (GRCm39) missense probably null
R5479:Dnah7b UTSW 1 46,262,265 (GRCm39) missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46,281,359 (GRCm39) missense probably benign 0.06
R5637:Dnah7b UTSW 1 46,395,674 (GRCm39) missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46,307,924 (GRCm39) splice site probably null
R5659:Dnah7b UTSW 1 46,392,009 (GRCm39) missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46,273,152 (GRCm39) missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46,316,280 (GRCm39) missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46,181,292 (GRCm39) missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46,230,885 (GRCm39) missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46,376,753 (GRCm39) critical splice donor site probably null
R5918:Dnah7b UTSW 1 46,260,803 (GRCm39) missense probably benign
R5941:Dnah7b UTSW 1 46,226,450 (GRCm39) missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46,402,147 (GRCm39) missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46,158,558 (GRCm39) splice site probably null
R6041:Dnah7b UTSW 1 46,328,805 (GRCm39) missense probably benign 0.04
R6043:Dnah7b UTSW 1 46,178,949 (GRCm39) missense probably benign
R6049:Dnah7b UTSW 1 46,124,762 (GRCm39) missense probably benign
R6131:Dnah7b UTSW 1 46,292,626 (GRCm39) missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46,329,863 (GRCm39) missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46,272,745 (GRCm39) missense probably benign 0.03
R6226:Dnah7b UTSW 1 46,165,828 (GRCm39) missense probably benign 0.01
R6233:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46,265,048 (GRCm39) missense probably benign
R6273:Dnah7b UTSW 1 46,281,476 (GRCm39) missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46,379,335 (GRCm39) missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46,281,364 (GRCm39) nonsense probably null
R6494:Dnah7b UTSW 1 46,138,591 (GRCm39) missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46,263,902 (GRCm39) missense probably benign 0.12
R6800:Dnah7b UTSW 1 46,379,377 (GRCm39) missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46,230,948 (GRCm39) missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46,234,280 (GRCm39) missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46,158,428 (GRCm39) missense probably benign 0.12
R6969:Dnah7b UTSW 1 46,397,398 (GRCm39) missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46,234,299 (GRCm39) critical splice donor site probably null
R7040:Dnah7b UTSW 1 46,275,969 (GRCm39) missense probably benign 0.01
R7117:Dnah7b UTSW 1 46,391,973 (GRCm39) critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46,178,870 (GRCm39) missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.05
R7189:Dnah7b UTSW 1 46,281,302 (GRCm39) missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46,179,126 (GRCm39) missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46,122,914 (GRCm39) missense probably benign
R7244:Dnah7b UTSW 1 46,316,303 (GRCm39) missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46,181,245 (GRCm39) missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46,234,532 (GRCm39) missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46,342,794 (GRCm39) missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46,214,579 (GRCm39) missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46,329,894 (GRCm39) missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46,364,925 (GRCm39) missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46,395,714 (GRCm39) missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46,163,506 (GRCm39) missense probably benign 0.06
R7547:Dnah7b UTSW 1 46,253,573 (GRCm39) missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46,307,794 (GRCm39) missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46,148,462 (GRCm39) missense probably benign
R7676:Dnah7b UTSW 1 46,273,324 (GRCm39) nonsense probably null
R7731:Dnah7b UTSW 1 46,178,905 (GRCm39) missense probably benign 0.00
R7760:Dnah7b UTSW 1 46,240,413 (GRCm39) missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46,176,634 (GRCm39) missense probably benign
R7807:Dnah7b UTSW 1 46,253,527 (GRCm39) missense probably benign
R7895:Dnah7b UTSW 1 46,289,110 (GRCm39) missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46,178,838 (GRCm39) missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
R7944:Dnah7b UTSW 1 46,266,163 (GRCm39) missense probably benign
R7946:Dnah7b UTSW 1 46,272,739 (GRCm39) missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46,282,584 (GRCm39) missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46,282,525 (GRCm39) missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46,263,866 (GRCm39) nonsense probably null
R8094:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.01
R8137:Dnah7b UTSW 1 46,272,913 (GRCm39) missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46,292,671 (GRCm39) missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46,395,736 (GRCm39) missense probably benign 0.43
R8309:Dnah7b UTSW 1 46,179,032 (GRCm39) missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46,214,456 (GRCm39) missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46,395,819 (GRCm39) critical splice donor site probably null
R8438:Dnah7b UTSW 1 46,227,839 (GRCm39) missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46,329,875 (GRCm39) missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46,138,650 (GRCm39) missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46,155,360 (GRCm39) missense possibly damaging 0.94
R8711:Dnah7b UTSW 1 46,214,598 (GRCm39) missense probably damaging 1.00
R8745:Dnah7b UTSW 1 46,221,624 (GRCm39) missense possibly damaging 0.82
R8765:Dnah7b UTSW 1 46,392,159 (GRCm39) missense possibly damaging 0.91
R8797:Dnah7b UTSW 1 46,162,806 (GRCm39) missense probably damaging 1.00
R8805:Dnah7b UTSW 1 46,273,305 (GRCm39) missense possibly damaging 0.90
R8830:Dnah7b UTSW 1 46,230,953 (GRCm39) missense probably damaging 1.00
R8861:Dnah7b UTSW 1 46,280,236 (GRCm39) missense possibly damaging 0.82
R8905:Dnah7b UTSW 1 46,292,534 (GRCm39) missense probably damaging 0.99
R9009:Dnah7b UTSW 1 46,262,232 (GRCm39) missense probably benign 0.00
R9058:Dnah7b UTSW 1 46,282,575 (GRCm39) missense probably damaging 1.00
R9130:Dnah7b UTSW 1 46,173,674 (GRCm39) missense probably benign 0.01
R9131:Dnah7b UTSW 1 46,266,180 (GRCm39) missense probably damaging 1.00
R9181:Dnah7b UTSW 1 46,181,194 (GRCm39) missense probably damaging 1.00
R9182:Dnah7b UTSW 1 46,330,038 (GRCm39) missense probably benign 0.06
R9223:Dnah7b UTSW 1 46,361,420 (GRCm39) missense probably benign 0.12
R9391:Dnah7b UTSW 1 46,272,914 (GRCm39) nonsense probably null
R9392:Dnah7b UTSW 1 46,162,898 (GRCm39) nonsense probably null
R9456:Dnah7b UTSW 1 46,165,953 (GRCm39) missense possibly damaging 0.82
R9498:Dnah7b UTSW 1 46,253,564 (GRCm39) missense probably benign 0.27
R9598:Dnah7b UTSW 1 46,292,621 (GRCm39) missense possibly damaging 0.67
R9653:Dnah7b UTSW 1 46,252,544 (GRCm39) missense possibly damaging 0.55
R9781:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
RF020:Dnah7b UTSW 1 46,412,421 (GRCm39) missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46,412,458 (GRCm39) nonsense probably null
X0023:Dnah7b UTSW 1 46,342,737 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTGATATTAGTGTCCCAAACAGG -3'
(R):5'- AGGGTGACGTCAGCTGTTAC -3'

Sequencing Primer
(F):5'- ATTAGTGTCCCAAACAGGTAATTAC -3'
(R):5'- CTAGGGATGCTTTCATAGGAACATG -3'
Posted On 2022-08-09