Mutagenetix > Incidental Mutation

Incidental Mutation 'R9553:Speg'

720589

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9553 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 75418001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 1785 (I1785L)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000087122
AA Change: I1785L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: I1785L

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410002F23Rik	C	T	7: 44,250,910	R80W	probably damaging	Het
Ankdd1b	G	T	13: 96,454,786	N68K	possibly damaging	Het
Arhgef1	A	G	7: 24,919,690	E452G	probably damaging	Het
Cbx8	T	G	11: 119,040,138	E45D	probably damaging	Het
Ceacam15	T	C	7: 16,673,391	Y67C	probably damaging	Het
Ceacam20	A	G	7: 19,990,001	Y570C	probably damaging	Het
Cnga4	A	G	7: 105,405,770	Y187C	probably damaging	Het
Cntrob	T	C	11: 69,314,853	N385S	probably benign	Het
Coro7	A	G	16: 4,668,760	V183A	possibly damaging	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Dnah7b	A	G	1: 46,225,796	Y2150C	probably damaging	Het
E2f8	A	G	7: 48,878,646	S25P	probably damaging	Het
Eif3d	T	C	15: 77,959,637	E503G	probably damaging	Het
Elp6	T	A	9: 110,315,897	V157D	probably damaging	Het
Entpd3	T	C	9: 120,558,480	Y248H	probably damaging	Het
Fam186a	T	C	15: 99,946,680	E561G	unknown	Het
Fbxl13	C	T	5: 21,523,153	G519S	probably damaging	Het
Fgfr4	T	G	13: 55,161,415	S422A	probably damaging	Het
Flg2	G	A	3: 93,214,594	C1357Y	unknown	Het
Fpr3	T	A	17: 17,971,350	N294K	probably damaging	Het
Gas6	T	C	8: 13,475,048	Q312R	possibly damaging	Het
Glg1	C	T	8: 111,200,138	E182K	probably benign	Het
Gm5662	A	G	12: 88,271,706	Y95H	probably damaging	Het
Gm7534	G	A	4: 134,202,001	P331L	probably benign	Het
Gucy1b1	T	C	3: 82,039,780	D374G	probably damaging	Het
Ifrd2	C	T	9: 107,591,086	T251I	possibly damaging	Het
Igkv4-91	C	T	6: 68,768,648	G89R	possibly damaging	Het
Kcnk1	C	A	8: 126,029,583	Y281*	probably null	Het
Kcp	G	T	6: 29,485,101	F1217L	probably null	Het
Lama3	G	A	18: 12,429,962	G514D	probably damaging	Het
Madd	A	G	2: 91,178,455	L34P	probably damaging	Het
Mak	T	A	13: 41,030,119	T562S	probably benign	Het
Nfatc4	A	G	14: 55,832,802	E879G	probably damaging	Het
Olfr1137	A	T	2: 87,711,648	V86E	probably benign	Het
Pcdhb19	C	T	18: 37,498,795	R548C	probably damaging	Het
Peli2	A	G	14: 48,250,693	I165V	probably damaging	Het
Plekhd1	A	T	12: 80,707,203	M148L	probably benign	Het
Rars2	G	A	4: 34,637,014	G172R	probably damaging	Het
Reck	T	C	4: 43,928,310	V537A	probably damaging	Het
Rnf135	T	A	11: 80,183,932	S6T	probably benign	Het
Sirpb1a	C	T	3: 15,411,260	C226Y	probably damaging	Het
Spry4	T	C	18: 38,590,017	N231S	probably damaging	Het
Tchh	C	T	3: 93,447,818	Q1522*	probably null	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Trav7d-3	G	T	14: 52,744,363		probably benign	Het
Vmn2r49	A	C	7: 9,986,922	V214G	probably benign	Het
Vmn2r80	T	C	10: 79,148,909	Y32H	probably benign	Het
Vwf	A	C	6: 125,600,699	D501A		Het
Zfp428	A	G	7: 24,515,441	T161A	possibly damaging	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0483:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1759:Speg	UTSW	1	75401162	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R1936:Speg	UTSW	1	75431408	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75430477	missense	probably benign	0.30
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75387869	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6505:Speg	UTSW	1	75429523	missense	possibly damaging	0.93
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75406770	critical splice donor site	probably null
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75384835	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75431279	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75431309	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75402264	splice site	probably null
R8781:Speg	UTSW	1	75407021	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75405149	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75427438	critical splice donor site	probably null
R8881:Speg	UTSW	1	75401151	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75388873	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75422606	missense	probably benign	0.30
R9019:Speg	UTSW	1	75429238	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75388432	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75385010	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75422734	missense	probably benign	0.01
R9117:Speg	UTSW	1	75387800	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75390993	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75384854	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75421776	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75417733	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75422508	missense	probably benign
R9475:Speg	UTSW	1	75388091	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75415736	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75387803	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75422782	missense	probably benign	0.08
R9767:Speg	UTSW	1	75427181	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75418973	nonsense	probably null
R9800:Speg	UTSW	1	75422714	missense	probably benign	0.03
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTTATAGCCGGAGAACCTGC -3'
(R):5'- TACCAGTCTCATCTGTGGAGGC -3'

Sequencing Primer
(F):5'- CCGGAGAACCTGCTTGTGTG -3'
(R):5'- AAGCGGAGATCTGATGCCC -3'

Posted On

2022-08-09