Incidental Mutation 'R9554:Helz2'
ID 720646
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9554 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 180869408-180883820 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 180882470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 108 (T108S)
Ref Sequence ENSEMBL: ENSMUSP00000091756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000094203
AA Change: T108S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: T108S

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108831
AA Change: T108S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: T108S

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121484
AA Change: T108S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: T108S

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,029,107 (GRCm39) E817G probably benign Het
Abhd12b A G 12: 70,215,988 (GRCm39) T182A probably benign Het
Allc A T 12: 28,607,414 (GRCm39) C279* probably null Het
Ang A G 14: 51,338,976 (GRCm39) D39G probably damaging Het
Atp8b3 G A 10: 80,360,197 (GRCm39) T958M probably damaging Het
Ccn4 G A 15: 66,784,900 (GRCm39) R191K probably benign Het
Ccnyl1 A G 1: 64,753,750 (GRCm39) Y187C probably damaging Het
Cfhr4 A T 1: 139,668,169 (GRCm39) S321R probably benign Het
Chd3 A T 11: 69,251,015 (GRCm39) W616R probably damaging Het
Cyp17a1 C T 19: 46,657,165 (GRCm39) R361H probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dcp1a A G 14: 30,201,691 (GRCm39) Q38R probably benign Het
Ddias T C 7: 92,507,560 (GRCm39) N785S probably benign Het
Depdc5 A G 5: 33,122,076 (GRCm39) N1133S probably benign Het
Dhx8 T A 11: 101,645,614 (GRCm39) Y877* probably null Het
Dlk1 G A 12: 109,420,889 (GRCm39) V15I unknown Het
Fam120b G A 17: 15,626,020 (GRCm39) A458T possibly damaging Het
Fgd4 G A 16: 16,308,353 (GRCm39) T9I probably benign Het
Fhip1b C A 7: 105,038,915 (GRCm39) R108L probably damaging Het
Gfpt1 C T 6: 87,062,323 (GRCm39) R561W probably damaging Het
Gm5773 A G 3: 93,680,340 (GRCm39) D4G probably benign Het
Hivep1 G A 13: 42,308,251 (GRCm39) D164N possibly damaging Het
Kif15 G T 9: 122,828,585 (GRCm39) L902F probably damaging Het
Lrp2 T A 2: 69,261,497 (GRCm39) R4481S probably damaging Het
Mcm3ap T C 10: 76,332,310 (GRCm39) V1209A probably damaging Het
Mkrn1 C T 6: 39,376,838 (GRCm39) R377H probably benign Het
Ms4a4a G A 19: 11,367,708 (GRCm39) M191I probably benign Het
Myh11 T A 16: 14,018,580 (GRCm39) N1922I Het
Nbeal1 C T 1: 60,290,287 (GRCm39) Q998* probably null Het
Neil3 C A 8: 54,061,770 (GRCm39) G204C probably damaging Het
Nsmce1 T C 7: 125,066,994 (GRCm39) E262G possibly damaging Het
Oc90 G A 15: 65,761,437 (GRCm39) P194S probably benign Het
Oplah A G 15: 76,193,787 (GRCm39) S57P probably benign Het
Or10u4 A T 10: 129,802,181 (GRCm39) F123L probably benign Het
Or1x6 T A 11: 50,939,223 (GRCm39) Y96* probably null Het
Or2aj4 T A 16: 19,384,722 (GRCm39) I304F possibly damaging Het
Or4a73 C A 2: 89,420,710 (GRCm39) V250F probably damaging Het
Or4d5 T A 9: 40,012,160 (GRCm39) M209L probably benign Het
Or51g1 A T 7: 102,633,774 (GRCm39) I199N probably damaging Het
Or5p70 A G 7: 107,994,365 (GRCm39) T13A probably benign Het
Or8g28 A C 9: 39,169,756 (GRCm39) F71V possibly damaging Het
Pdzd8 A T 19: 59,333,574 (GRCm39) L149Q probably damaging Het
Pid1 A G 1: 84,137,032 (GRCm39) V33A probably benign Het
Polr3gl A G 3: 96,489,037 (GRCm39) V60A possibly damaging Het
Prdm1 A G 10: 44,317,242 (GRCm39) V527A probably benign Het
Sbf2 T C 7: 110,040,671 (GRCm39) I385M probably damaging Het
Setbp1 C T 18: 78,826,599 (GRCm39) S1338N probably benign Het
Sh2b2 T C 5: 136,253,006 (GRCm39) T389A probably benign Het
Skint9 A T 4: 112,248,915 (GRCm39) M171K probably benign Het
Slx4 C A 16: 3,805,820 (GRCm39) M577I probably benign Het
Srcap T C 7: 127,151,577 (GRCm39) S2092P probably damaging Het
Traf6 T A 2: 101,518,953 (GRCm39) H147Q probably benign Het
Ttn T A 2: 76,547,693 (GRCm39) E32159V possibly damaging Het
Ubn1 T C 16: 4,888,492 (GRCm39) S154P unknown Het
Uchl1 T A 5: 66,833,649 (GRCm39) M6K probably damaging Het
Vmn1r193 A T 13: 22,403,989 (GRCm39) M1K probably null Het
Zfp429 T A 13: 67,538,531 (GRCm39) K304N probably benign Het
Zfp607b T A 7: 27,402,464 (GRCm39) S307T probably damaging Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 180,871,495 (GRCm39) missense probably damaging 1.00
IGL00515:Helz2 APN 2 180,874,799 (GRCm39) nonsense probably null
IGL00704:Helz2 APN 2 180,876,178 (GRCm39) missense probably damaging 1.00
IGL00847:Helz2 APN 2 180,874,038 (GRCm39) missense possibly damaging 0.73
IGL01448:Helz2 APN 2 180,875,770 (GRCm39) missense probably damaging 1.00
IGL01783:Helz2 APN 2 180,874,674 (GRCm39) missense probably damaging 1.00
IGL01790:Helz2 APN 2 180,880,274 (GRCm39) missense probably benign 0.29
IGL02116:Helz2 APN 2 180,873,978 (GRCm39) missense probably damaging 1.00
IGL02226:Helz2 APN 2 180,873,483 (GRCm39) missense probably damaging 1.00
IGL02402:Helz2 APN 2 180,872,704 (GRCm39) missense probably damaging 1.00
IGL02403:Helz2 APN 2 180,872,815 (GRCm39) missense probably damaging 1.00
IGL02733:Helz2 APN 2 180,876,819 (GRCm39) missense probably benign 0.14
IGL02869:Helz2 APN 2 180,872,939 (GRCm39) intron probably benign
IGL03003:Helz2 APN 2 180,882,046 (GRCm39) missense probably damaging 1.00
IGL03060:Helz2 APN 2 180,871,015 (GRCm39) critical splice donor site probably null
IGL03310:Helz2 APN 2 180,873,597 (GRCm39) missense probably benign 0.00
Colby UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
ANU74:Helz2 UTSW 2 180,876,627 (GRCm39) missense probably benign 0.03
R0013:Helz2 UTSW 2 180,882,752 (GRCm39) missense probably benign
R0013:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0016:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0018:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0111:Helz2 UTSW 2 180,879,595 (GRCm39) missense probably benign 0.30
R0117:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0135:Helz2 UTSW 2 180,874,062 (GRCm39) missense probably damaging 1.00
R0194:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0254:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0410:Helz2 UTSW 2 180,872,386 (GRCm39) missense probably damaging 1.00
R0442:Helz2 UTSW 2 180,874,002 (GRCm39) missense probably damaging 0.97
R0497:Helz2 UTSW 2 180,871,449 (GRCm39) missense probably damaging 0.97
R0517:Helz2 UTSW 2 180,869,563 (GRCm39) missense probably benign 0.00
R0541:Helz2 UTSW 2 180,876,618 (GRCm39) missense possibly damaging 0.89
R0542:Helz2 UTSW 2 180,873,882 (GRCm39) missense probably damaging 1.00
R0591:Helz2 UTSW 2 180,873,909 (GRCm39) missense probably damaging 0.96
R0692:Helz2 UTSW 2 180,882,674 (GRCm39) missense probably benign
R0826:Helz2 UTSW 2 180,882,646 (GRCm39) missense possibly damaging 0.51
R0834:Helz2 UTSW 2 180,872,570 (GRCm39) missense probably damaging 1.00
R0880:Helz2 UTSW 2 180,877,928 (GRCm39) missense probably benign
R1170:Helz2 UTSW 2 180,871,608 (GRCm39) missense probably damaging 1.00
R1186:Helz2 UTSW 2 180,872,921 (GRCm39) missense probably damaging 1.00
R1344:Helz2 UTSW 2 180,879,389 (GRCm39) missense possibly damaging 0.89
R1358:Helz2 UTSW 2 180,874,774 (GRCm39) missense probably damaging 1.00
R1436:Helz2 UTSW 2 180,877,317 (GRCm39) missense probably damaging 0.99
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1477:Helz2 UTSW 2 180,874,597 (GRCm39) missense probably benign 0.00
R1564:Helz2 UTSW 2 180,875,021 (GRCm39) missense probably benign 0.01
R1584:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1655:Helz2 UTSW 2 180,875,940 (GRCm39) missense probably damaging 0.99
R1757:Helz2 UTSW 2 180,878,056 (GRCm39) missense probably damaging 1.00
R1779:Helz2 UTSW 2 180,880,252 (GRCm39) missense possibly damaging 0.84
R1779:Helz2 UTSW 2 180,876,780 (GRCm39) missense probably benign
R1837:Helz2 UTSW 2 180,871,082 (GRCm39) missense probably damaging 1.00
R1845:Helz2 UTSW 2 180,873,878 (GRCm39) missense probably benign 0.02
R1894:Helz2 UTSW 2 180,876,082 (GRCm39) missense probably damaging 1.00
R1913:Helz2 UTSW 2 180,875,543 (GRCm39) missense probably damaging 1.00
R2005:Helz2 UTSW 2 180,873,122 (GRCm39) missense probably benign 0.45
R2034:Helz2 UTSW 2 180,874,371 (GRCm39) missense probably damaging 1.00
R2036:Helz2 UTSW 2 180,879,272 (GRCm39) missense probably benign 0.03
R2061:Helz2 UTSW 2 180,882,337 (GRCm39) missense probably damaging 1.00
R2088:Helz2 UTSW 2 180,876,895 (GRCm39) missense probably benign 0.07
R2142:Helz2 UTSW 2 180,873,173 (GRCm39) missense probably benign
R2180:Helz2 UTSW 2 180,875,525 (GRCm39) missense probably damaging 1.00
R2192:Helz2 UTSW 2 180,870,841 (GRCm39) nonsense probably null
R2248:Helz2 UTSW 2 180,875,226 (GRCm39) missense probably benign 0.33
R2495:Helz2 UTSW 2 180,874,705 (GRCm39) missense probably damaging 0.99
R2886:Helz2 UTSW 2 180,882,535 (GRCm39) missense probably benign
R3617:Helz2 UTSW 2 180,874,854 (GRCm39) missense probably damaging 1.00
R3776:Helz2 UTSW 2 180,882,182 (GRCm39) nonsense probably null
R3803:Helz2 UTSW 2 180,881,789 (GRCm39) missense probably damaging 0.96
R4043:Helz2 UTSW 2 180,871,503 (GRCm39) missense probably benign 0.00
R4052:Helz2 UTSW 2 180,882,268 (GRCm39) missense probably damaging 1.00
R4232:Helz2 UTSW 2 180,871,695 (GRCm39) missense probably damaging 1.00
R4521:Helz2 UTSW 2 180,870,626 (GRCm39) missense probably benign
R4624:Helz2 UTSW 2 180,881,101 (GRCm39) missense probably damaging 0.99
R4720:Helz2 UTSW 2 180,880,210 (GRCm39) missense probably damaging 1.00
R4831:Helz2 UTSW 2 180,879,210 (GRCm39) missense probably damaging 1.00
R4852:Helz2 UTSW 2 180,871,913 (GRCm39) missense probably damaging 1.00
R4894:Helz2 UTSW 2 180,877,940 (GRCm39) missense probably benign 0.01
R4915:Helz2 UTSW 2 180,874,231 (GRCm39) missense possibly damaging 0.80
R4965:Helz2 UTSW 2 180,882,709 (GRCm39) missense possibly damaging 0.79
R5022:Helz2 UTSW 2 180,882,362 (GRCm39) missense probably benign
R5089:Helz2 UTSW 2 180,876,942 (GRCm39) missense probably benign 0.14
R5190:Helz2 UTSW 2 180,872,550 (GRCm39) critical splice donor site probably null
R5309:Helz2 UTSW 2 180,876,639 (GRCm39) missense probably benign 0.08
R5358:Helz2 UTSW 2 180,877,321 (GRCm39) missense probably damaging 1.00
R5379:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R5559:Helz2 UTSW 2 180,871,919 (GRCm39) missense probably damaging 0.98
R5591:Helz2 UTSW 2 180,882,051 (GRCm39) missense probably damaging 0.99
R5596:Helz2 UTSW 2 180,879,082 (GRCm39) intron probably benign
R5805:Helz2 UTSW 2 180,882,301 (GRCm39) missense probably damaging 1.00
R5823:Helz2 UTSW 2 180,878,189 (GRCm39) missense possibly damaging 0.92
R5825:Helz2 UTSW 2 180,874,449 (GRCm39) missense probably benign 0.02
R5873:Helz2 UTSW 2 180,875,821 (GRCm39) missense possibly damaging 0.78
R5928:Helz2 UTSW 2 180,872,177 (GRCm39) missense possibly damaging 0.82
R5936:Helz2 UTSW 2 180,872,560 (GRCm39) missense probably damaging 1.00
R5975:Helz2 UTSW 2 180,872,843 (GRCm39) missense probably benign 0.08
R6045:Helz2 UTSW 2 180,882,106 (GRCm39) missense probably benign 0.03
R6077:Helz2 UTSW 2 180,874,831 (GRCm39) missense probably benign 0.41
R6218:Helz2 UTSW 2 180,874,087 (GRCm39) missense probably benign 0.03
R6218:Helz2 UTSW 2 180,877,738 (GRCm39) missense probably damaging 1.00
R6315:Helz2 UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
R6346:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6371:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6372:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6373:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6385:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6464:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R6581:Helz2 UTSW 2 180,871,172 (GRCm39) missense probably damaging 0.99
R6651:Helz2 UTSW 2 180,881,350 (GRCm39) nonsense probably null
R6964:Helz2 UTSW 2 180,872,221 (GRCm39) missense probably damaging 1.00
R7061:Helz2 UTSW 2 180,882,307 (GRCm39) missense probably damaging 1.00
R7153:Helz2 UTSW 2 180,873,078 (GRCm39) missense probably benign 0.00
R7372:Helz2 UTSW 2 180,880,216 (GRCm39) missense possibly damaging 0.61
R7512:Helz2 UTSW 2 180,877,393 (GRCm39) splice site probably null
R7512:Helz2 UTSW 2 180,872,647 (GRCm39) missense probably benign 0.00
R7583:Helz2 UTSW 2 180,879,365 (GRCm39) missense probably benign 0.06
R7724:Helz2 UTSW 2 180,873,789 (GRCm39) missense probably damaging 1.00
R7733:Helz2 UTSW 2 180,872,148 (GRCm39) missense possibly damaging 0.63
R7748:Helz2 UTSW 2 180,876,324 (GRCm39) missense probably damaging 1.00
R7774:Helz2 UTSW 2 180,875,784 (GRCm39) missense probably benign
R7799:Helz2 UTSW 2 180,879,782 (GRCm39) missense probably benign 0.15
R7841:Helz2 UTSW 2 180,874,695 (GRCm39) missense probably damaging 1.00
R7939:Helz2 UTSW 2 180,879,543 (GRCm39) missense probably damaging 0.99
R8026:Helz2 UTSW 2 180,881,998 (GRCm39) missense probably benign 0.34
R8030:Helz2 UTSW 2 180,879,689 (GRCm39) missense possibly damaging 0.55
R8080:Helz2 UTSW 2 180,880,055 (GRCm39) missense probably damaging 0.99
R8237:Helz2 UTSW 2 180,871,124 (GRCm39) missense possibly damaging 0.65
R8245:Helz2 UTSW 2 180,879,895 (GRCm39) missense probably damaging 1.00
R8304:Helz2 UTSW 2 180,871,950 (GRCm39) missense probably benign 0.03
R8486:Helz2 UTSW 2 180,871,124 (GRCm39) missense probably damaging 1.00
R8556:Helz2 UTSW 2 180,871,350 (GRCm39) missense probably damaging 1.00
R8878:Helz2 UTSW 2 180,874,560 (GRCm39) missense possibly damaging 0.67
R8907:Helz2 UTSW 2 180,874,920 (GRCm39) missense possibly damaging 0.47
R8911:Helz2 UTSW 2 180,880,173 (GRCm39) missense
R8953:Helz2 UTSW 2 180,874,884 (GRCm39) missense probably damaging 1.00
R8963:Helz2 UTSW 2 180,871,407 (GRCm39) missense probably damaging 1.00
R8969:Helz2 UTSW 2 180,879,581 (GRCm39) missense probably benign 0.19
R8976:Helz2 UTSW 2 180,876,486 (GRCm39) missense possibly damaging 0.46
R9015:Helz2 UTSW 2 180,870,792 (GRCm39) missense probably damaging 1.00
R9031:Helz2 UTSW 2 180,874,261 (GRCm39) missense possibly damaging 0.78
R9052:Helz2 UTSW 2 180,881,968 (GRCm39) missense possibly damaging 0.78
R9089:Helz2 UTSW 2 180,881,433 (GRCm39) missense probably damaging 1.00
R9145:Helz2 UTSW 2 180,881,848 (GRCm39) missense probably damaging 1.00
R9185:Helz2 UTSW 2 180,871,883 (GRCm39) missense probably benign
R9186:Helz2 UTSW 2 180,876,457 (GRCm39) missense possibly damaging 0.57
R9373:Helz2 UTSW 2 180,882,741 (GRCm39) missense probably benign
R9407:Helz2 UTSW 2 180,881,975 (GRCm39) missense probably benign 0.01
R9465:Helz2 UTSW 2 180,874,710 (GRCm39) missense probably benign 0.01
R9502:Helz2 UTSW 2 180,878,245 (GRCm39) missense possibly damaging 0.47
R9538:Helz2 UTSW 2 180,882,014 (GRCm39) missense probably damaging 1.00
R9659:Helz2 UTSW 2 180,882,025 (GRCm39) missense probably benign 0.00
R9800:Helz2 UTSW 2 180,882,616 (GRCm39) missense probably damaging 0.99
X0064:Helz2 UTSW 2 180,873,534 (GRCm39) missense probably damaging 1.00
Z1176:Helz2 UTSW 2 180,879,357 (GRCm39) missense probably benign 0.39
Z1177:Helz2 UTSW 2 180,877,754 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGTTGGAAGTGGCCACC -3'
(R):5'- GTAGACCTTTACCTGGGCTG -3'

Sequencing Primer
(F):5'- CAAACTCTGCTCGGATGGTGTC -3'
(R):5'- AGAGTACCTACATTCTGCGTGAG -3'
Posted On 2022-08-09