Incidental Mutation 'R9554:Dhx8'
ID 720674
Institutional Source Beutler Lab
Gene Symbol Dhx8
Ensembl Gene ENSMUSG00000034931
Gene Name DEAH-box helicase 8
Synonyms RNA helicase, Ddx8, mDEAH6
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R9554 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 101623782-101658184 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 101645614 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 877 (Y877*)
Ref Sequence ENSEMBL: ENSMUSP00000037251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039152] [ENSMUST00000129741]
AlphaFold A2A4P0
Predicted Effect probably null
Transcript: ENSMUST00000039152
AA Change: Y877*
SMART Domains Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931
AA Change: Y877*

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 168 240 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
S1 287 360 3.52e-18 SMART
low complexity region 453 469 N/A INTRINSIC
coiled coil region 496 525 N/A INTRINSIC
DEXDc 587 771 7.26e-33 SMART
HELICc 815 919 7.45e-21 SMART
HA2 980 1070 1.34e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129741
AA Change: Y824*
SMART Domains Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931
AA Change: Y824*

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 115 187 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
S1 234 307 3.52e-18 SMART
low complexity region 400 416 N/A INTRINSIC
coiled coil region 443 472 N/A INTRINSIC
DEXDc 534 718 7.26e-33 SMART
HELICc 762 866 7.45e-21 SMART
HA2 927 1017 1.34e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH box polypeptide family. The encoded protein contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus. This protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,029,107 (GRCm39) E817G probably benign Het
Abhd12b A G 12: 70,215,988 (GRCm39) T182A probably benign Het
Allc A T 12: 28,607,414 (GRCm39) C279* probably null Het
Ang A G 14: 51,338,976 (GRCm39) D39G probably damaging Het
Atp8b3 G A 10: 80,360,197 (GRCm39) T958M probably damaging Het
Ccn4 G A 15: 66,784,900 (GRCm39) R191K probably benign Het
Ccnyl1 A G 1: 64,753,750 (GRCm39) Y187C probably damaging Het
Cfhr4 A T 1: 139,668,169 (GRCm39) S321R probably benign Het
Chd3 A T 11: 69,251,015 (GRCm39) W616R probably damaging Het
Cyp17a1 C T 19: 46,657,165 (GRCm39) R361H probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dcp1a A G 14: 30,201,691 (GRCm39) Q38R probably benign Het
Ddias T C 7: 92,507,560 (GRCm39) N785S probably benign Het
Depdc5 A G 5: 33,122,076 (GRCm39) N1133S probably benign Het
Dlk1 G A 12: 109,420,889 (GRCm39) V15I unknown Het
Fam120b G A 17: 15,626,020 (GRCm39) A458T possibly damaging Het
Fgd4 G A 16: 16,308,353 (GRCm39) T9I probably benign Het
Fhip1b C A 7: 105,038,915 (GRCm39) R108L probably damaging Het
Gfpt1 C T 6: 87,062,323 (GRCm39) R561W probably damaging Het
Gm5773 A G 3: 93,680,340 (GRCm39) D4G probably benign Het
Helz2 T A 2: 180,882,470 (GRCm39) T108S probably damaging Het
Hivep1 G A 13: 42,308,251 (GRCm39) D164N possibly damaging Het
Kif15 G T 9: 122,828,585 (GRCm39) L902F probably damaging Het
Lrp2 T A 2: 69,261,497 (GRCm39) R4481S probably damaging Het
Mcm3ap T C 10: 76,332,310 (GRCm39) V1209A probably damaging Het
Mkrn1 C T 6: 39,376,838 (GRCm39) R377H probably benign Het
Ms4a4a G A 19: 11,367,708 (GRCm39) M191I probably benign Het
Myh11 T A 16: 14,018,580 (GRCm39) N1922I Het
Nbeal1 C T 1: 60,290,287 (GRCm39) Q998* probably null Het
Neil3 C A 8: 54,061,770 (GRCm39) G204C probably damaging Het
Nsmce1 T C 7: 125,066,994 (GRCm39) E262G possibly damaging Het
Oc90 G A 15: 65,761,437 (GRCm39) P194S probably benign Het
Oplah A G 15: 76,193,787 (GRCm39) S57P probably benign Het
Or10u4 A T 10: 129,802,181 (GRCm39) F123L probably benign Het
Or1x6 T A 11: 50,939,223 (GRCm39) Y96* probably null Het
Or2aj4 T A 16: 19,384,722 (GRCm39) I304F possibly damaging Het
Or4a73 C A 2: 89,420,710 (GRCm39) V250F probably damaging Het
Or4d5 T A 9: 40,012,160 (GRCm39) M209L probably benign Het
Or51g1 A T 7: 102,633,774 (GRCm39) I199N probably damaging Het
Or5p70 A G 7: 107,994,365 (GRCm39) T13A probably benign Het
Or8g28 A C 9: 39,169,756 (GRCm39) F71V possibly damaging Het
Pdzd8 A T 19: 59,333,574 (GRCm39) L149Q probably damaging Het
Pid1 A G 1: 84,137,032 (GRCm39) V33A probably benign Het
Polr3gl A G 3: 96,489,037 (GRCm39) V60A possibly damaging Het
Prdm1 A G 10: 44,317,242 (GRCm39) V527A probably benign Het
Sbf2 T C 7: 110,040,671 (GRCm39) I385M probably damaging Het
Setbp1 C T 18: 78,826,599 (GRCm39) S1338N probably benign Het
Sh2b2 T C 5: 136,253,006 (GRCm39) T389A probably benign Het
Skint9 A T 4: 112,248,915 (GRCm39) M171K probably benign Het
Slx4 C A 16: 3,805,820 (GRCm39) M577I probably benign Het
Srcap T C 7: 127,151,577 (GRCm39) S2092P probably damaging Het
Traf6 T A 2: 101,518,953 (GRCm39) H147Q probably benign Het
Ttn T A 2: 76,547,693 (GRCm39) E32159V possibly damaging Het
Ubn1 T C 16: 4,888,492 (GRCm39) S154P unknown Het
Uchl1 T A 5: 66,833,649 (GRCm39) M6K probably damaging Het
Vmn1r193 A T 13: 22,403,989 (GRCm39) M1K probably null Het
Zfp429 T A 13: 67,538,531 (GRCm39) K304N probably benign Het
Zfp607b T A 7: 27,402,464 (GRCm39) S307T probably damaging Het
Other mutations in Dhx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Dhx8 APN 11 101,630,633 (GRCm39) missense probably damaging 0.99
IGL01957:Dhx8 APN 11 101,645,652 (GRCm39) missense possibly damaging 0.48
IGL02039:Dhx8 APN 11 101,654,853 (GRCm39) critical splice donor site probably null
IGL02115:Dhx8 APN 11 101,643,214 (GRCm39) missense probably damaging 1.00
IGL02161:Dhx8 APN 11 101,648,432 (GRCm39) missense probably damaging 1.00
IGL02691:Dhx8 APN 11 101,642,830 (GRCm39) splice site probably benign
IGL02697:Dhx8 APN 11 101,645,607 (GRCm39) missense probably damaging 1.00
FR4304:Dhx8 UTSW 11 101,629,014 (GRCm39) small insertion probably benign
FR4342:Dhx8 UTSW 11 101,629,032 (GRCm39) frame shift probably null
FR4449:Dhx8 UTSW 11 101,629,020 (GRCm39) small insertion probably benign
FR4449:Dhx8 UTSW 11 101,629,032 (GRCm39) small insertion probably benign
FR4449:Dhx8 UTSW 11 101,629,033 (GRCm39) small insertion probably benign
FR4449:Dhx8 UTSW 11 101,629,010 (GRCm39) small insertion probably benign
FR4449:Dhx8 UTSW 11 101,629,016 (GRCm39) small deletion probably benign
FR4589:Dhx8 UTSW 11 101,629,014 (GRCm39) small insertion probably benign
FR4737:Dhx8 UTSW 11 101,629,015 (GRCm39) small insertion probably benign
FR4737:Dhx8 UTSW 11 101,629,005 (GRCm39) small insertion probably benign
FR4737:Dhx8 UTSW 11 101,629,008 (GRCm39) small insertion probably benign
R0402:Dhx8 UTSW 11 101,643,223 (GRCm39) missense probably damaging 1.00
R0525:Dhx8 UTSW 11 101,654,754 (GRCm39) missense probably damaging 1.00
R0969:Dhx8 UTSW 11 101,630,526 (GRCm39) splice site probably benign
R1497:Dhx8 UTSW 11 101,626,213 (GRCm39) intron probably benign
R1576:Dhx8 UTSW 11 101,643,145 (GRCm39) missense probably damaging 1.00
R1758:Dhx8 UTSW 11 101,657,564 (GRCm39) missense probably damaging 1.00
R1773:Dhx8 UTSW 11 101,643,189 (GRCm39) missense possibly damaging 0.87
R1941:Dhx8 UTSW 11 101,643,024 (GRCm39) critical splice donor site probably null
R1954:Dhx8 UTSW 11 101,644,105 (GRCm39) missense probably damaging 0.98
R2124:Dhx8 UTSW 11 101,653,071 (GRCm39) missense probably damaging 0.99
R2128:Dhx8 UTSW 11 101,629,235 (GRCm39) missense probably benign 0.06
R2148:Dhx8 UTSW 11 101,629,203 (GRCm39) nonsense probably null
R2206:Dhx8 UTSW 11 101,641,797 (GRCm39) missense probably benign 0.03
R2207:Dhx8 UTSW 11 101,641,797 (GRCm39) missense probably benign 0.03
R4667:Dhx8 UTSW 11 101,628,987 (GRCm39) missense unknown
R4678:Dhx8 UTSW 11 101,630,634 (GRCm39) missense probably damaging 1.00
R4825:Dhx8 UTSW 11 101,628,996 (GRCm39) nonsense probably null
R4943:Dhx8 UTSW 11 101,628,526 (GRCm39) nonsense probably null
R5341:Dhx8 UTSW 11 101,629,016 (GRCm39) small deletion probably benign
R5586:Dhx8 UTSW 11 101,623,862 (GRCm39) unclassified probably benign
R5662:Dhx8 UTSW 11 101,657,584 (GRCm39) missense possibly damaging 0.89
R5664:Dhx8 UTSW 11 101,631,577 (GRCm39) missense probably damaging 1.00
R6082:Dhx8 UTSW 11 101,655,139 (GRCm39) missense probably damaging 1.00
R6085:Dhx8 UTSW 11 101,655,139 (GRCm39) missense probably damaging 1.00
R6415:Dhx8 UTSW 11 101,628,513 (GRCm39) missense unknown
R6658:Dhx8 UTSW 11 101,655,748 (GRCm39) missense probably damaging 1.00
R6841:Dhx8 UTSW 11 101,655,618 (GRCm39) missense probably damaging 0.98
R6918:Dhx8 UTSW 11 101,629,247 (GRCm39) nonsense probably null
R7011:Dhx8 UTSW 11 101,632,346 (GRCm39) missense probably damaging 1.00
R7098:Dhx8 UTSW 11 101,628,594 (GRCm39) critical splice donor site probably null
R7153:Dhx8 UTSW 11 101,631,001 (GRCm39) splice site probably null
R7284:Dhx8 UTSW 11 101,645,648 (GRCm39) missense probably damaging 1.00
R7604:Dhx8 UTSW 11 101,655,623 (GRCm39) missense probably damaging 1.00
R8135:Dhx8 UTSW 11 101,629,090 (GRCm39) missense unknown
R8137:Dhx8 UTSW 11 101,654,808 (GRCm39) missense probably damaging 1.00
R8256:Dhx8 UTSW 11 101,631,588 (GRCm39) missense possibly damaging 0.93
R8284:Dhx8 UTSW 11 101,648,455 (GRCm39) missense probably damaging 1.00
R8289:Dhx8 UTSW 11 101,631,571 (GRCm39) missense probably benign 0.01
R8696:Dhx8 UTSW 11 101,623,958 (GRCm39) missense unknown
R9061:Dhx8 UTSW 11 101,632,406 (GRCm39) missense possibly damaging 0.61
R9076:Dhx8 UTSW 11 101,629,021 (GRCm39) missense
R9443:Dhx8 UTSW 11 101,655,740 (GRCm39) missense probably damaging 1.00
R9492:Dhx8 UTSW 11 101,654,808 (GRCm39) missense possibly damaging 0.67
R9700:Dhx8 UTSW 11 101,624,015 (GRCm39) critical splice donor site probably null
R9780:Dhx8 UTSW 11 101,632,403 (GRCm39) missense possibly damaging 0.73
Z1177:Dhx8 UTSW 11 101,648,486 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGGAACCCTTCAGATGCG -3'
(R):5'- AAGGCCCTGTCTTGAAACAAATG -3'

Sequencing Primer
(F):5'- ACCCTTCAGATGCGGGCAC -3'
(R):5'- AGGTTCTGAGTTCAAATCCCAGC -3'
Posted On 2022-08-09