Mutagenetix > Incidental Mutation

Incidental Mutation 'R9554:Olfr169'

720691

Institutional Source

Beutler Lab

Gene Symbol

Olfr169

Ensembl Gene

ENSMUSG00000068535

Gene Name

olfactory receptor 169

Synonyms

GA_x54KRFPKG5P-16014972-16014031, MOR273-3P

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R9554 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19564889-19571809 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19565972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 304 (I304F)

Ref Sequence

ENSEMBL: ENSMUSP00000149087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090062] [ENSMUST00000215040] [ENSMUST00000215476] [ENSMUST00000216070]

AlphaFold

Q7TS53

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090062
AA Change: I304F

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000087516
Gene: ENSMUSG00000068535
AA Change: I304F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	28	308	1.3e-45	PFAM
Pfam:7TM_GPCR_Srsx	35	303	2e-6	PFAM
Pfam:7tm_1	41	290	7.4e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215040
AA Change: I304F

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215476
AA Change: I304F

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216070
AA Change: I304F

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,138,281	E817G	probably benign	Het
Abhd12b	A	G	12: 70,169,214	T182A	probably benign	Het
Allc	A	T	12: 28,557,415	C279*	probably null	Het
Ang	A	G	14: 51,101,519	D39G	probably damaging	Het
Atp8b3	G	A	10: 80,524,363	T958M	probably damaging	Het
Ccnyl1	A	G	1: 64,714,591	Y187C	probably damaging	Het
Chd3	A	T	11: 69,360,189	W616R	probably damaging	Het
Cyp17a1	C	T	19: 46,668,726	R361H	probably damaging	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Dcp1a	A	G	14: 30,479,734	Q38R	probably benign	Het
Ddias	T	C	7: 92,858,352	N785S	probably benign	Het
Depdc5	A	G	5: 32,964,732	N1133S	probably benign	Het
Dhx8	T	A	11: 101,754,788	Y877*	probably null	Het
Dlk1	G	A	12: 109,454,963	V15I	unknown	Het
Fam120b	G	A	17: 15,405,758	A458T	possibly damaging	Het
Fam160a2	C	A	7: 105,389,708	R108L	probably damaging	Het
Fgd4	G	A	16: 16,490,489	T9I	probably benign	Het
Gfpt1	C	T	6: 87,085,341	R561W	probably damaging	Het
Gm4788	A	T	1: 139,740,431	S321R	probably benign	Het
Gm5773	A	G	3: 93,773,033	D4G	probably benign	Het
Helz2	T	A	2: 181,240,677	T108S	probably damaging	Het
Hivep1	G	A	13: 42,154,775	D164N	possibly damaging	Het
Kif15	G	T	9: 122,999,520	L902F	probably damaging	Het
Lrp2	T	A	2: 69,431,153	R4481S	probably damaging	Het
Mcm3ap	T	C	10: 76,496,476	V1209A	probably damaging	Het
Mkrn1	C	T	6: 39,399,904	R377H	probably benign	Het
Ms4a4a	G	A	19: 11,390,344	M191I	probably benign	Het
Myh11	T	A	16: 14,200,716	N1922I		Het
Nbeal1	C	T	1: 60,251,128	Q998*	probably null	Het
Neil3	C	A	8: 53,608,735	G204C	probably damaging	Het
Nsmce1	T	C	7: 125,467,822	E262G	possibly damaging	Het
Oc90	G	A	15: 65,889,588	P194S	probably benign	Het
Olfr1246	C	A	2: 89,590,366	V250F	probably damaging	Het
Olfr1375	T	A	11: 51,048,396	Y96*	probably null	Het
Olfr495	A	G	7: 108,395,158	T13A	probably benign	Het
Olfr578	A	T	7: 102,984,567	I199N	probably damaging	Het
Olfr819	A	T	10: 129,966,312	F123L	probably benign	Het
Olfr945	A	C	9: 39,258,460	F71V	possibly damaging	Het
Olfr984	T	A	9: 40,100,864	M209L	probably benign	Het
Oplah	A	G	15: 76,309,587	S57P	probably benign	Het
Pdzd8	A	T	19: 59,345,142	L149Q	probably damaging	Het
Pid1	A	G	1: 84,159,311	V33A	probably benign	Het
Polr3gl	A	G	3: 96,581,721	V60A	possibly damaging	Het
Prdm1	A	G	10: 44,441,246	V527A	probably benign	Het
Sbf2	T	C	7: 110,441,464	I385M	probably damaging	Het
Setbp1	C	T	18: 78,783,384	S1338N	probably benign	Het
Sh2b2	T	C	5: 136,224,152	T389A	probably benign	Het
Skint9	A	T	4: 112,391,718	M171K	probably benign	Het
Slx4	C	A	16: 3,987,956	M577I	probably benign	Het
Srcap	T	C	7: 127,552,405	S2092P	probably damaging	Het
Traf6	T	A	2: 101,688,608	H147Q	probably benign	Het
Ttn	T	A	2: 76,717,349	E32159V	possibly damaging	Het
Ubn1	T	C	16: 5,070,628	S154P	unknown	Het
Uchl1	T	A	5: 66,676,306	M6K	probably damaging	Het
Vmn1r193	A	T	13: 22,219,819	M1K	probably null	Het
Wisp1	G	A	15: 66,913,051	R191K	probably benign	Het
Zfp429	T	A	13: 67,390,412	K304N	probably benign	Het
Zfp607b	T	A	7: 27,703,039	S307T	probably damaging	Het

Other mutations in Olfr169

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01080:Olfr169	APN	16	19566208	missense	probably damaging	1.00
IGL01862:Olfr169	APN	16	19566676	missense	probably damaging	1.00
IGL02064:Olfr169	APN	16	19566548	missense	probably damaging	1.00
IGL03061:Olfr169	APN	16	19566713	missense	possibly damaging	0.87
IGL03136:Olfr169	APN	16	19566353	missense	probably damaging	1.00
R0066:Olfr169	UTSW	16	19566049	missense	probably damaging	1.00
R0243:Olfr169	UTSW	16	19566294	missense	probably damaging	0.97
R0629:Olfr169	UTSW	16	19565980	missense	possibly damaging	0.88
R1644:Olfr169	UTSW	16	19566406	missense	probably benign	0.11
R1943:Olfr169	UTSW	16	19566437	missense	probably benign	0.19
R3016:Olfr169	UTSW	16	19566391	missense	probably damaging	1.00
R4290:Olfr169	UTSW	16	19566244	missense	possibly damaging	0.88
R4689:Olfr169	UTSW	16	19566513	nonsense	probably null
R4791:Olfr169	UTSW	16	19566663	missense	possibly damaging	0.50
R5497:Olfr169	UTSW	16	19566330	missense	probably benign	0.10
R5843:Olfr169	UTSW	16	19566583	missense	probably damaging	1.00
R6106:Olfr169	UTSW	16	19566259	missense	probably damaging	0.99
R6249:Olfr169	UTSW	16	19565975	missense	probably damaging	0.99
R7895:Olfr169	UTSW	16	19566722	nonsense	probably null
R9284:Olfr169	UTSW	16	19566607	missense	probably damaging	1.00
R9335:Olfr169	UTSW	16	19566763	missense	probably benign	0.32
R9364:Olfr169	UTSW	16	19565972	missense	possibly damaging	0.68
R9404:Olfr169	UTSW	16	19565981	missense	probably benign	0.01
R9475:Olfr169	UTSW	16	19566520	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TTGCCTTACTACAGCATAGCAAG -3'
(R):5'- CCCGGCAAAAGTCCTTTTC -3'

Sequencing Primer
(F):5'- GCAAGACTTTACCATGGGCATCTG -3'
(R):5'- GGCAAAAGTCCTTTTCCACCTG -3'

Posted On

2022-08-09