Incidental Mutation 'R9554:Cyp17a1'
ID 720695
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms p450c17, Cyp17, steroid 17-alpha hydroxylase
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R9554 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46655604-46661439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 46657165 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 361 (R361H)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably damaging
Transcript: ENSMUST00000026012
AA Change: R361H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: R361H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,029,107 (GRCm39) E817G probably benign Het
Abhd12b A G 12: 70,215,988 (GRCm39) T182A probably benign Het
Allc A T 12: 28,607,414 (GRCm39) C279* probably null Het
Ang A G 14: 51,338,976 (GRCm39) D39G probably damaging Het
Atp8b3 G A 10: 80,360,197 (GRCm39) T958M probably damaging Het
Ccn4 G A 15: 66,784,900 (GRCm39) R191K probably benign Het
Ccnyl1 A G 1: 64,753,750 (GRCm39) Y187C probably damaging Het
Cfhr4 A T 1: 139,668,169 (GRCm39) S321R probably benign Het
Chd3 A T 11: 69,251,015 (GRCm39) W616R probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Dcp1a A G 14: 30,201,691 (GRCm39) Q38R probably benign Het
Ddias T C 7: 92,507,560 (GRCm39) N785S probably benign Het
Depdc5 A G 5: 33,122,076 (GRCm39) N1133S probably benign Het
Dhx8 T A 11: 101,645,614 (GRCm39) Y877* probably null Het
Dlk1 G A 12: 109,420,889 (GRCm39) V15I unknown Het
Fam120b G A 17: 15,626,020 (GRCm39) A458T possibly damaging Het
Fgd4 G A 16: 16,308,353 (GRCm39) T9I probably benign Het
Fhip1b C A 7: 105,038,915 (GRCm39) R108L probably damaging Het
Gfpt1 C T 6: 87,062,323 (GRCm39) R561W probably damaging Het
Gm5773 A G 3: 93,680,340 (GRCm39) D4G probably benign Het
Helz2 T A 2: 180,882,470 (GRCm39) T108S probably damaging Het
Hivep1 G A 13: 42,308,251 (GRCm39) D164N possibly damaging Het
Kif15 G T 9: 122,828,585 (GRCm39) L902F probably damaging Het
Lrp2 T A 2: 69,261,497 (GRCm39) R4481S probably damaging Het
Mcm3ap T C 10: 76,332,310 (GRCm39) V1209A probably damaging Het
Mkrn1 C T 6: 39,376,838 (GRCm39) R377H probably benign Het
Ms4a4a G A 19: 11,367,708 (GRCm39) M191I probably benign Het
Myh11 T A 16: 14,018,580 (GRCm39) N1922I Het
Nbeal1 C T 1: 60,290,287 (GRCm39) Q998* probably null Het
Neil3 C A 8: 54,061,770 (GRCm39) G204C probably damaging Het
Nsmce1 T C 7: 125,066,994 (GRCm39) E262G possibly damaging Het
Oc90 G A 15: 65,761,437 (GRCm39) P194S probably benign Het
Oplah A G 15: 76,193,787 (GRCm39) S57P probably benign Het
Or10u4 A T 10: 129,802,181 (GRCm39) F123L probably benign Het
Or1x6 T A 11: 50,939,223 (GRCm39) Y96* probably null Het
Or2aj4 T A 16: 19,384,722 (GRCm39) I304F possibly damaging Het
Or4a73 C A 2: 89,420,710 (GRCm39) V250F probably damaging Het
Or4d5 T A 9: 40,012,160 (GRCm39) M209L probably benign Het
Or51g1 A T 7: 102,633,774 (GRCm39) I199N probably damaging Het
Or5p70 A G 7: 107,994,365 (GRCm39) T13A probably benign Het
Or8g28 A C 9: 39,169,756 (GRCm39) F71V possibly damaging Het
Pdzd8 A T 19: 59,333,574 (GRCm39) L149Q probably damaging Het
Pid1 A G 1: 84,137,032 (GRCm39) V33A probably benign Het
Polr3gl A G 3: 96,489,037 (GRCm39) V60A possibly damaging Het
Prdm1 A G 10: 44,317,242 (GRCm39) V527A probably benign Het
Sbf2 T C 7: 110,040,671 (GRCm39) I385M probably damaging Het
Setbp1 C T 18: 78,826,599 (GRCm39) S1338N probably benign Het
Sh2b2 T C 5: 136,253,006 (GRCm39) T389A probably benign Het
Skint9 A T 4: 112,248,915 (GRCm39) M171K probably benign Het
Slx4 C A 16: 3,805,820 (GRCm39) M577I probably benign Het
Srcap T C 7: 127,151,577 (GRCm39) S2092P probably damaging Het
Traf6 T A 2: 101,518,953 (GRCm39) H147Q probably benign Het
Ttn T A 2: 76,547,693 (GRCm39) E32159V possibly damaging Het
Ubn1 T C 16: 4,888,492 (GRCm39) S154P unknown Het
Uchl1 T A 5: 66,833,649 (GRCm39) M6K probably damaging Het
Vmn1r193 A T 13: 22,403,989 (GRCm39) M1K probably null Het
Zfp429 T A 13: 67,538,531 (GRCm39) K304N probably benign Het
Zfp607b T A 7: 27,402,464 (GRCm39) S307T probably damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46,659,495 (GRCm39) missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46,659,110 (GRCm39) missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46,659,531 (GRCm39) missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46,661,046 (GRCm39) nonsense probably null
IGL02349:Cyp17a1 APN 19 46,655,936 (GRCm39) missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46,661,005 (GRCm39) missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46,657,790 (GRCm39) missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46,661,050 (GRCm39) missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46,655,796 (GRCm39) missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46,659,474 (GRCm39) missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46,658,162 (GRCm39) missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46,658,990 (GRCm39) missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46,661,093 (GRCm39) missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46,661,095 (GRCm39) missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46,657,761 (GRCm39) missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46,661,159 (GRCm39) missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46,657,673 (GRCm39) missense probably benign
R6729:Cyp17a1 UTSW 19 46,659,020 (GRCm39) missense probably benign
R7025:Cyp17a1 UTSW 19 46,659,419 (GRCm39) missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46,659,134 (GRCm39) missense probably benign
R8056:Cyp17a1 UTSW 19 46,659,030 (GRCm39) missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46,656,516 (GRCm39) missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46,659,533 (GRCm39) critical splice acceptor site probably null
R8737:Cyp17a1 UTSW 19 46,658,166 (GRCm39) missense probably benign 0.09
R9091:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9270:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46,659,459 (GRCm39) missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46,661,098 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAGCAGGAGTCTCTGTTTG -3'
(R):5'- AGAATCATTCAGGCTGTTCTGGG -3'

Sequencing Primer
(F):5'- CAGCAGGAGTCTCTGTTTGACTATAG -3'
(R):5'- AGGCTGTTCTGGGTATGACCAC -3'
Posted On 2022-08-09