Incidental Mutation 'R9555:Pdzrn4'
ID 720723
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene Name PDZ domain containing RING finger 4
Synonyms 1110017D07Rik, SAMCAP3L, LNX4
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R9555 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 92294762-92669700 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 92297703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 223 (R223C)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169942]
AlphaFold E9PUZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000169942
AA Change: R223C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: R223C

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,586,947 (GRCm39) V259A probably benign Het
Abcd4 T C 12: 84,661,949 (GRCm39) I63V probably benign Het
Agps C A 2: 75,683,091 (GRCm39) P139T probably damaging Het
B130006D01Rik A T 11: 95,616,956 (GRCm39) H27L unknown Het
BC024139 A G 15: 76,005,359 (GRCm39) V501A possibly damaging Het
Cacul1 A T 19: 60,533,887 (GRCm39) Y238* probably null Het
Cep55 T C 19: 38,059,592 (GRCm39) probably null Het
Csf1r T A 18: 61,243,473 (GRCm39) I163N possibly damaging Het
Ddx3y G T Y: 1,265,895 (GRCm39) D367E probably benign Het
Ecpas T A 4: 58,879,083 (GRCm39) I69L possibly damaging Het
Epb41l4a A G 18: 34,009,966 (GRCm39) V213A possibly damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Klrb1a T C 6: 128,595,427 (GRCm39) E142G probably damaging Het
Lamb3 A T 1: 193,011,113 (GRCm39) I369F possibly damaging Het
Lig1 T C 7: 13,025,400 (GRCm39) V254A probably benign Het
Lrp1b T A 2: 40,741,693 (GRCm39) D3192V Het
Lrp1b T C 2: 40,748,438 (GRCm39) D3134G Het
Map1s T A 8: 71,367,236 (GRCm39) S714T probably benign Het
Marchf2 A G 17: 33,922,129 (GRCm39) L77P probably damaging Het
Nek8 A G 11: 78,067,390 (GRCm39) F15L probably benign Het
Or1s2 T A 19: 13,758,360 (GRCm39) I126N probably damaging Het
Per1 T A 11: 68,995,574 (GRCm39) V718D probably benign Het
Pik3ca A G 3: 32,505,916 (GRCm39) H676R probably damaging Het
Pla2g4e C A 2: 120,075,400 (GRCm39) probably benign Het
Proser1 A T 3: 53,378,876 (GRCm39) I103F possibly damaging Het
Pyroxd1 G A 6: 142,300,421 (GRCm39) A184T possibly damaging Het
Rin2 C T 2: 145,718,415 (GRCm39) Q632* probably null Het
Serpinb12 C T 1: 106,884,345 (GRCm39) H364Y probably damaging Het
Sfxn3 G A 19: 45,038,211 (GRCm39) E64K probably benign Het
Slc38a1 C T 15: 96,486,860 (GRCm39) V199M possibly damaging Het
Tep1 A G 14: 51,105,888 (GRCm39) I44T possibly damaging Het
Trip13 T A 13: 74,084,252 (GRCm39) T78S probably benign Het
Trmt11 T C 10: 30,470,150 (GRCm39) D58G possibly damaging Het
Usp28 A T 9: 48,952,736 (GRCm39) I1015F probably damaging Het
Vcan T C 13: 89,839,659 (GRCm39) T1962A Het
Vmn2r100 T A 17: 19,743,857 (GRCm39) S507T probably benign Het
Vmn2r91 C T 17: 18,325,792 (GRCm39) P137S possibly damaging Het
Zfp84 G T 7: 29,476,102 (GRCm39) V265F probably damaging Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92,644,159 (GRCm39) missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92,299,807 (GRCm39) splice site probably null
IGL02103:Pdzrn4 APN 15 92,667,768 (GRCm39) missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92,668,577 (GRCm39) missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92,667,731 (GRCm39) missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92,668,272 (GRCm39) missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92,667,762 (GRCm39) missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92,668,200 (GRCm39) missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92,655,538 (GRCm39) missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92,655,592 (GRCm39) missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92,668,152 (GRCm39) missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92,668,894 (GRCm39) makesense probably null
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92,575,593 (GRCm39) missense probably benign
R1503:Pdzrn4 UTSW 15 92,297,685 (GRCm39) missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92,575,518 (GRCm39) missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92,299,855 (GRCm39) missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92,644,190 (GRCm39) splice site probably null
R2061:Pdzrn4 UTSW 15 92,668,041 (GRCm39) missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92,667,692 (GRCm39) missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92,297,630 (GRCm39) missense probably benign
R4032:Pdzrn4 UTSW 15 92,667,414 (GRCm39) missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92,668,745 (GRCm39) missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92,299,898 (GRCm39) missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92,668,470 (GRCm39) missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92,667,723 (GRCm39) missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92,668,133 (GRCm39) nonsense probably null
R4900:Pdzrn4 UTSW 15 92,668,638 (GRCm39) missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92,575,502 (GRCm39) missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92,668,806 (GRCm39) missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92,295,255 (GRCm39) missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92,578,418 (GRCm39) missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92,575,455 (GRCm39) missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92,668,303 (GRCm39) nonsense probably null
R7096:Pdzrn4 UTSW 15 92,295,384 (GRCm39) missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92,667,948 (GRCm39) missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92,575,605 (GRCm39) missense probably damaging 0.99
R8125:Pdzrn4 UTSW 15 92,641,476 (GRCm39) missense probably damaging 1.00
R8324:Pdzrn4 UTSW 15 92,668,818 (GRCm39) missense probably damaging 1.00
R9332:Pdzrn4 UTSW 15 92,295,216 (GRCm39) missense probably benign
R9558:Pdzrn4 UTSW 15 92,299,877 (GRCm39) missense possibly damaging 0.46
R9622:Pdzrn4 UTSW 15 92,294,949 (GRCm39) missense probably benign
R9763:Pdzrn4 UTSW 15 92,668,376 (GRCm39) missense probably damaging 1.00
R9796:Pdzrn4 UTSW 15 92,578,353 (GRCm39) missense possibly damaging 0.93
X0018:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92,575,590 (GRCm39) missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92,578,393 (GRCm39) missense possibly damaging 0.92
X0027:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0065:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92,294,838 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCAAGCATCCTTACGAGTCTTC -3'
(R):5'- TCGAGATGATCAACTGTGGAGTG -3'

Sequencing Primer
(F):5'- ACGAGTCTTCTCTATTAACAGTACAG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On 2022-08-09