Mutagenetix > Incidental Mutation

Incidental Mutation 'R9555:Pdzrn4'

720723

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R9555 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 92399822 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 223 (R223C)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000169942
AA Change: R223C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: R223C

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930453N24Rik	A	G	16: 64,766,584	V259A	probably benign	Het
Abcd4	T	C	12: 84,615,175	I63V	probably benign	Het
Agps	C	A	2: 75,852,747	P139T	probably damaging	Het
AI314180	T	A	4: 58,879,083	I69L	possibly damaging	Het
B130006D01Rik	A	T	11: 95,726,130	H27L	unknown	Het
BC024139	A	G	15: 76,121,159	V501A	possibly damaging	Het
Cacul1	A	T	19: 60,545,449	Y238*	probably null	Het
Cep55	T	C	19: 38,071,144		probably null	Het
Csf1r	T	A	18: 61,110,401	I163N	possibly damaging	Het
Ddx3y	G	T	Y: 1,265,895	D367E	probably benign	Het
Epb41l4a	A	G	18: 33,876,913	V213A	possibly damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Klrb1a	T	C	6: 128,618,464	E142G	probably damaging	Het
Lamb3	A	T	1: 193,328,805	I369F	possibly damaging	Het
Lig1	T	C	7: 13,291,474	V254A	probably benign	Het
Lrp1b	T	A	2: 40,851,681	D3192V		Het
Lrp1b	T	C	2: 40,858,426	D3134G		Het
Map1s	T	A	8: 70,914,592	S714T	probably benign	Het
March2	A	G	17: 33,703,155	L77P	probably damaging	Het
Nek8	A	G	11: 78,176,564	F15L	probably benign	Het
Olfr1496	T	A	19: 13,780,996	I126N	probably damaging	Het
Per1	T	A	11: 69,104,748	V718D	probably benign	Het
Pik3ca	A	G	3: 32,451,767	H676R	probably damaging	Het
Pla2g4e	C	A	2: 120,244,919		probably benign	Het
Proser1	A	T	3: 53,471,455	I103F	possibly damaging	Het
Pyroxd1	G	A	6: 142,354,695	A184T	possibly damaging	Het
Rin2	C	T	2: 145,876,495	Q632*	probably null	Het
Serpinb12	C	T	1: 106,956,615	H364Y	probably damaging	Het
Sfxn3	G	A	19: 45,049,772	E64K	probably benign	Het
Slc38a1	C	T	15: 96,588,979	V199M	possibly damaging	Het
Tep1	A	G	14: 50,868,431	I44T	possibly damaging	Het
Trip13	T	A	13: 73,936,133	T78S	probably benign	Het
Trmt11	T	C	10: 30,594,154	D58G	possibly damaging	Het
Usp28	A	T	9: 49,041,436	I1015F	probably damaging	Het
Vcan	T	C	13: 89,691,540	T1962A		Het
Vmn2r100	T	A	17: 19,523,595	S507T	probably benign	Het
Vmn2r91	C	T	17: 18,105,530	P137S	possibly damaging	Het
Zfp84	G	T	7: 29,776,677	V265F	probably damaging	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GTCAAGCATCCTTACGAGTCTTC -3'
(R):5'- TCGAGATGATCAACTGTGGAGTG -3'

Sequencing Primer
(F):5'- ACGAGTCTTCTCTATTAACAGTACAG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'

Posted On

2022-08-09