Incidental Mutation 'R9556:Nusap1'
ID 720738
Institutional Source Beutler Lab
Gene Symbol Nusap1
Ensembl Gene ENSMUSG00000027306
Gene Name nucleolar and spindle associated protein 1
Synonyms 2610201A12Rik, NuSAP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9556 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 119618298-119651244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119648963 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 420 (N420D)
Ref Sequence ENSEMBL: ENSMUSP00000068713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028771] [ENSMUST00000068225]
AlphaFold Q9ERH4
Predicted Effect possibly damaging
Transcript: ENSMUST00000028771
AA Change: N387D

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028771
Gene: ENSMUSG00000027306
AA Change: N387D

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
coiled coil region 360 392 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068225
AA Change: N420D

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068713
Gene: ENSMUSG00000027306
AA Change: N420D

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
Pfam:NUSAP 167 261 6e-27 PFAM
Pfam:NUSAP 256 421 2.3e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Early embryos homozygous for a knock-out allele are small and exhibit disorganized embryonic tissue, abnormal chromatin-induced spindle assembly, abnormal inner cell mass apoptosis, and complete embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A T 9: 104,319,979 Y183N probably damaging Het
Agtr1a A T 13: 30,381,090 N46I probably damaging Het
Aldh1a1 T C 19: 20,623,392 V191A possibly damaging Het
Apmap A C 2: 150,587,115 M196R possibly damaging Het
Ddb2 G T 2: 91,234,857 Y74* probably null Het
Ddx11 A G 17: 66,140,212 T436A probably benign Het
Edc4 TAGCAGCAGCAGCAGCAGCAGCAGC TAGCAGCAGCAGCAGCAGCAGC 8: 105,888,435 probably benign Het
Ghdc A T 11: 100,768,035 C424S possibly damaging Het
Gm16368 G A 12: 88,083,740 G15D probably damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm7347 G A 5: 26,054,998 R185C probably benign Het
Gys2 C T 6: 142,428,651 R556H probably damaging Het
Hoxa1 ATGGTGGTGGTGGTGGTGGTGGTGGTGG ATGGTGGTGGTGGTGGTGGTGGTGG 6: 52,158,003 probably benign Het
Igsf21 A C 4: 140,034,703 D221E probably damaging Het
Izumo3 A T 4: 92,146,880 D33E possibly damaging Het
Kcnu1 A C 8: 25,858,126 I107L probably damaging Het
Mme C A 3: 63,364,804 T608K probably damaging Het
Mpdz A T 4: 81,360,026 I774K probably damaging Het
Muc16 A G 9: 18,658,638 S862P unknown Het
Ncbp2 T A 16: 31,956,940 V134D probably damaging Het
Nr5a2 A T 1: 136,890,722 H416Q possibly damaging Het
Nsmaf A T 4: 6,408,637 M714K probably benign Het
Olfr1451 T C 19: 12,999,574 I196T probably benign Het
Olfr872 G T 9: 20,260,355 V172L probably benign Het
Phlpp2 A G 8: 109,940,126 T1096A probably benign Het
Ppp1r14a A G 7: 29,289,519 E62G probably damaging Het
Scgb3a2 T A 18: 43,766,974 V109E unknown Het
Slc26a1 T C 5: 108,672,538 N281S Het
Slc35a3 T A 3: 116,681,114 I210F possibly damaging Het
Slco3a1 A T 7: 74,552,157 D16E probably benign Het
Tbcd G A 11: 121,576,227 A638T probably damaging Het
Tes A T 6: 17,096,234 T74S probably benign Het
Ugt2a2 G A 5: 87,461,962 T420I probably damaging Het
Washc5 T C 15: 59,346,867 T684A possibly damaging Het
Zfp160 A G 17: 21,026,769 N527S probably benign Het
Zfp516 C A 18: 82,956,840 P388T probably benign Het
Zfp719 G A 7: 43,589,648 C220Y probably damaging Het
Other mutations in Nusap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Nusap1 APN 2 119648890 splice site probably benign
IGL02582:Nusap1 APN 2 119648989 makesense probably null
IGL02732:Nusap1 APN 2 119635580 missense probably damaging 0.96
IGL02794:Nusap1 APN 2 119630386 missense possibly damaging 0.80
R0635:Nusap1 UTSW 2 119627667 missense probably damaging 0.98
R2567:Nusap1 UTSW 2 119643830 missense possibly damaging 0.70
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3895:Nusap1 UTSW 2 119627691 missense possibly damaging 0.94
R4296:Nusap1 UTSW 2 119639648 missense probably damaging 1.00
R5111:Nusap1 UTSW 2 119630356 nonsense probably null
R5417:Nusap1 UTSW 2 119647143 missense probably damaging 0.98
R5754:Nusap1 UTSW 2 119647099 missense probably damaging 1.00
R5818:Nusap1 UTSW 2 119635513 missense possibly damaging 0.85
R6176:Nusap1 UTSW 2 119630421 missense probably benign 0.01
R7947:Nusap1 UTSW 2 119647135 missense possibly damaging 0.95
R9010:Nusap1 UTSW 2 119648975 missense possibly damaging 0.91
R9312:Nusap1 UTSW 2 119627638 small deletion probably benign
RF003:Nusap1 UTSW 2 119627603 small insertion probably benign
RF007:Nusap1 UTSW 2 119627581 small insertion probably benign
RF010:Nusap1 UTSW 2 119627584 small insertion probably benign
RF016:Nusap1 UTSW 2 119627601 small insertion probably benign
RF018:Nusap1 UTSW 2 119627578 small insertion probably benign
RF026:Nusap1 UTSW 2 119627590 small insertion probably benign
RF026:Nusap1 UTSW 2 119627604 small insertion probably benign
RF028:Nusap1 UTSW 2 119627578 small insertion probably benign
RF028:Nusap1 UTSW 2 119627591 small insertion probably benign
RF029:Nusap1 UTSW 2 119627594 small insertion probably benign
RF029:Nusap1 UTSW 2 119627605 small insertion probably benign
RF032:Nusap1 UTSW 2 119627587 small insertion probably benign
RF033:Nusap1 UTSW 2 119627600 small insertion probably benign
RF035:Nusap1 UTSW 2 119627579 small insertion probably benign
RF036:Nusap1 UTSW 2 119627587 small insertion probably benign
RF036:Nusap1 UTSW 2 119627594 small insertion probably benign
RF037:Nusap1 UTSW 2 119627589 small insertion probably benign
RF040:Nusap1 UTSW 2 119627587 small insertion probably benign
RF041:Nusap1 UTSW 2 119627579 small insertion probably benign
RF041:Nusap1 UTSW 2 119627593 small insertion probably benign
RF041:Nusap1 UTSW 2 119627607 nonsense probably null
RF042:Nusap1 UTSW 2 119627607 nonsense probably null
RF043:Nusap1 UTSW 2 119627592 small insertion probably benign
RF045:Nusap1 UTSW 2 119627610 small insertion probably benign
RF046:Nusap1 UTSW 2 119627595 nonsense probably null
RF048:Nusap1 UTSW 2 119627599 small insertion probably benign
RF049:Nusap1 UTSW 2 119627583 small insertion probably benign
RF052:Nusap1 UTSW 2 119627584 small insertion probably benign
RF056:Nusap1 UTSW 2 119627581 small insertion probably benign
RF056:Nusap1 UTSW 2 119627586 small insertion probably benign
RF056:Nusap1 UTSW 2 119627591 small insertion probably benign
RF062:Nusap1 UTSW 2 119627601 small insertion probably benign
RF062:Nusap1 UTSW 2 119627610 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TACCCAGTACCCAGTAGATGCC -3'
(R):5'- ACCTCTGTTAAGAATCATGAGGAC -3'

Sequencing Primer
(F):5'- GCCATTTAACTAGATGTTAGGCCAGC -3'
(R):5'- CTGTTAAGAATCATGAGGACAAGTC -3'
Posted On 2022-08-09