Incidental Mutation 'R9556:Phlpp2'
ID 720758
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene Name PH domain and leucine rich repeat protein phosphatase 2
Synonyms C130044A18Rik, Phlppl
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.249) question?
Stock # R9556 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 110595174-110671303 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110666758 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1096 (T1096A)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
AlphaFold Q8BXA7
Predicted Effect probably benign
Transcript: ENSMUST00000034175
AA Change: T1061A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: T1061A

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179721
AA Change: T1096A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: T1096A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp3 A T 9: 104,197,178 (GRCm39) Y183N probably damaging Het
Agtr1a A T 13: 30,565,073 (GRCm39) N46I probably damaging Het
Aldh1a1 T C 19: 20,600,756 (GRCm39) V191A possibly damaging Het
Apmap A C 2: 150,429,035 (GRCm39) M196R possibly damaging Het
Ddb2 G T 2: 91,065,202 (GRCm39) Y74* probably null Het
Ddx11 A G 17: 66,447,207 (GRCm39) T436A probably benign Het
Edc4 TAGCAGCAGCAGCAGCAGCAGCAGC TAGCAGCAGCAGCAGCAGCAGC 8: 106,615,067 (GRCm39) probably benign Het
Eif1ad18 G A 12: 88,050,510 (GRCm39) G15D probably damaging Het
Ghdc A T 11: 100,658,861 (GRCm39) C424S possibly damaging Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gm7347 G A 5: 26,259,996 (GRCm39) R185C probably benign Het
Gys2 C T 6: 142,374,377 (GRCm39) R556H probably damaging Het
Hoxa1 ATGGTGGTGGTGGTGGTGGTGGTGGTGG ATGGTGGTGGTGGTGGTGGTGGTGG 6: 52,134,983 (GRCm39) probably benign Het
Igsf21 A C 4: 139,762,014 (GRCm39) D221E probably damaging Het
Izumo3 A T 4: 92,035,117 (GRCm39) D33E possibly damaging Het
Kcnu1 A C 8: 26,348,154 (GRCm39) I107L probably damaging Het
Mme C A 3: 63,272,225 (GRCm39) T608K probably damaging Het
Mpdz A T 4: 81,278,263 (GRCm39) I774K probably damaging Het
Muc16 A G 9: 18,569,934 (GRCm39) S862P unknown Het
Ncbp2 T A 16: 31,775,758 (GRCm39) V134D probably damaging Het
Nr5a2 A T 1: 136,818,460 (GRCm39) H416Q possibly damaging Het
Nsmaf A T 4: 6,408,637 (GRCm39) M714K probably benign Het
Nusap1 A G 2: 119,479,444 (GRCm39) N420D possibly damaging Het
Or5b99 T C 19: 12,976,938 (GRCm39) I196T probably benign Het
Or7e176 G T 9: 20,171,651 (GRCm39) V172L probably benign Het
Ppp1r14a A G 7: 28,988,944 (GRCm39) E62G probably damaging Het
Scgb3a2 T A 18: 43,900,039 (GRCm39) V109E unknown Het
Slc26a1 T C 5: 108,820,404 (GRCm39) N281S Het
Slc35a3 T A 3: 116,474,763 (GRCm39) I210F possibly damaging Het
Slco3a1 A T 7: 74,201,905 (GRCm39) D16E probably benign Het
Tbcd G A 11: 121,467,053 (GRCm39) A638T probably damaging Het
Tes A T 6: 17,096,233 (GRCm39) T74S probably benign Het
Ugt2a2 G A 5: 87,609,821 (GRCm39) T420I probably damaging Het
Washc5 T C 15: 59,218,716 (GRCm39) T684A possibly damaging Het
Zfp160 A G 17: 21,247,031 (GRCm39) N527S probably benign Het
Zfp516 C A 18: 82,974,965 (GRCm39) P388T probably benign Het
Zfp719 G A 7: 43,239,072 (GRCm39) C220Y probably damaging Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 110,652,422 (GRCm39) missense probably benign 0.01
IGL01363:Phlpp2 APN 8 110,663,729 (GRCm39) missense probably benign 0.22
IGL01535:Phlpp2 APN 8 110,660,697 (GRCm39) missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 110,666,491 (GRCm39) missense probably benign
IGL02105:Phlpp2 APN 8 110,631,040 (GRCm39) missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 110,646,731 (GRCm39) missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 110,666,505 (GRCm39) missense probably benign 0.04
IGL02500:Phlpp2 APN 8 110,640,250 (GRCm39) missense probably benign
IGL03356:Phlpp2 APN 8 110,662,249 (GRCm39) missense probably benign 0.00
IGL03366:Phlpp2 APN 8 110,667,467 (GRCm39) missense probably benign 0.44
R0142:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 110,666,567 (GRCm39) missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 110,655,095 (GRCm39) missense probably benign 0.01
R0477:Phlpp2 UTSW 8 110,622,138 (GRCm39) critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 110,603,603 (GRCm39) missense probably benign 0.00
R0605:Phlpp2 UTSW 8 110,659,843 (GRCm39) missense probably benign 0.00
R0655:Phlpp2 UTSW 8 110,622,219 (GRCm39) missense probably benign 0.00
R0833:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 110,603,662 (GRCm39) nonsense probably null
R1417:Phlpp2 UTSW 8 110,667,313 (GRCm39) nonsense probably null
R1602:Phlpp2 UTSW 8 110,660,655 (GRCm39) missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 110,660,587 (GRCm39) splice site probably benign
R1815:Phlpp2 UTSW 8 110,666,855 (GRCm39) missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 110,634,232 (GRCm39) missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 110,666,634 (GRCm39) missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 110,634,245 (GRCm39) missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 110,603,515 (GRCm39) missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 110,667,452 (GRCm39) missense probably benign 0.31
R4739:Phlpp2 UTSW 8 110,667,052 (GRCm39) missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 110,603,642 (GRCm39) missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 110,666,714 (GRCm39) missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 110,640,251 (GRCm39) missense probably benign 0.04
R5074:Phlpp2 UTSW 8 110,652,461 (GRCm39) missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 110,660,667 (GRCm39) missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 110,630,976 (GRCm39) missense probably benign 0.01
R5668:Phlpp2 UTSW 8 110,655,205 (GRCm39) missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 110,661,317 (GRCm39) missense probably benign
R6470:Phlpp2 UTSW 8 110,663,826 (GRCm39) missense probably benign 0.45
R6804:Phlpp2 UTSW 8 110,655,197 (GRCm39) missense probably damaging 1.00
R7012:Phlpp2 UTSW 8 110,603,486 (GRCm39) missense possibly damaging 0.95
R7183:Phlpp2 UTSW 8 110,666,585 (GRCm39) missense probably damaging 1.00
R7257:Phlpp2 UTSW 8 110,666,820 (GRCm39) missense probably benign
R7312:Phlpp2 UTSW 8 110,666,785 (GRCm39) missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 110,655,278 (GRCm39) missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 110,652,474 (GRCm39) missense possibly damaging 0.56
R8059:Phlpp2 UTSW 8 110,622,189 (GRCm39) missense probably benign 0.00
R8174:Phlpp2 UTSW 8 110,595,321 (GRCm39) missense unknown
R8242:Phlpp2 UTSW 8 110,666,834 (GRCm39) missense probably benign 0.03
R8488:Phlpp2 UTSW 8 110,640,202 (GRCm39) missense probably benign
R8688:Phlpp2 UTSW 8 110,631,012 (GRCm39) missense probably damaging 1.00
R8843:Phlpp2 UTSW 8 110,652,431 (GRCm39) missense probably benign 0.18
R9154:Phlpp2 UTSW 8 110,666,590 (GRCm39) missense possibly damaging 0.82
R9737:Phlpp2 UTSW 8 110,663,714 (GRCm39) missense probably damaging 0.99
R9781:Phlpp2 UTSW 8 110,662,178 (GRCm39) missense possibly damaging 0.95
R9786:Phlpp2 UTSW 8 110,660,655 (GRCm39) nonsense probably null
X0018:Phlpp2 UTSW 8 110,639,001 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACGTGCAAGACCCACTAG -3'
(R):5'- TCCAGGCCATTGTCAGACTG -3'

Sequencing Primer
(F):5'- TGCAAGACCCACTAGCTGCTG -3'
(R):5'- CAGGCCATTGTCAGACTGATTGC -3'
Posted On 2022-08-09