Incidental Mutation 'R9557:Gm4787'
ID 720822
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R9557 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 81376991-81379464 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 81379300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 28 (L28*)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably null
Transcript: ENSMUST00000062182
AA Change: L28*
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: L28*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,306,283 L523P probably damaging Het
Adcy5 T C 16: 35,270,957 V590A probably damaging Het
Alg1 A T 16: 5,239,956 D238V probably damaging Het
Ankrd55 C A 13: 112,348,813 P187H probably damaging Het
Aox4 G T 1: 58,245,936 V616F probably benign Het
Apc C A 18: 34,318,359 H2769Q probably damaging Het
Bach1 C G 16: 87,719,715 S381R probably benign Het
C2cd2l G A 9: 44,319,830 A20V probably benign Het
Catsperg1 T C 7: 29,204,798 D266G probably damaging Het
Ces4a A G 8: 105,142,895 S233G possibly damaging Het
Comp T A 8: 70,377,204 D359E probably benign Het
Cyp2b13 A C 7: 26,080,698 N91T probably benign Het
Dhx9 A C 1: 153,457,546 M1151R probably benign Het
E2f5 G T 3: 14,588,251 L142F probably benign Het
Egflam G T 15: 7,212,175 N917K probably damaging Het
Ercc6l2 C T 13: 63,842,122 R254C probably damaging Het
Erh G A 12: 80,642,797 P18S probably benign Het
Fam110b T C 4: 5,799,064 S161P probably damaging Het
Fam210a TAAAATGTTCCAAA TAAA 18: 68,275,777 probably null Het
Fbn1 T C 2: 125,338,538 I1775V probably damaging Het
Fry C A 5: 150,466,316 Q137K Het
Gm5538 T A 3: 59,751,739 N204K possibly damaging Het
Gm8298 T G 3: 59,877,233 F376V possibly damaging Het
Gpr179 A G 11: 97,344,203 F434L probably damaging Het
Grik2 T C 10: 49,528,009 Y252C probably damaging Het
H1f0 C T 15: 79,028,747 P9L probably damaging Het
Hectd4 A G 5: 121,321,554 T829A possibly damaging Het
Ing4 A G 6: 125,048,391 E245G probably benign Het
Lgr4 C T 2: 109,996,739 A196V probably damaging Het
Lrrc51 T A 7: 101,913,122 K176N probably benign Het
Lrrc9 T A 12: 72,486,207 M950K probably benign Het
Lrrd1 A T 5: 3,851,432 D579V probably damaging Het
Magi3 C T 3: 104,015,157 A1415T probably benign Het
Magi3 A C 3: 104,017,617 I1072S probably damaging Het
Mast1 G A 8: 84,930,845 T101I probably damaging Het
Mccc1 A T 3: 35,995,827 V72E probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Megf8 A T 7: 25,359,086 Q2169L possibly damaging Het
Mllt6 A G 11: 97,673,484 D342G probably benign Het
Mycbp2 T A 14: 103,135,261 T4050S probably benign Het
Nbeal1 A G 1: 60,235,350 T307A probably benign Het
Olfr653 T C 7: 104,580,561 I305T probably damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Plat T C 8: 22,772,653 F125L probably benign Het
Ppm1b T A 17: 84,994,073 M127K probably benign Het
Ppp4r1 C A 17: 65,803,263 D52E probably benign Het
Rasgrp3 T G 17: 75,500,144 I201S probably damaging Het
Rfpl4b T A 10: 38,820,874 M244L probably benign Het
Rhbdl3 A T 11: 80,353,451 H328L probably benign Het
Rsad2 T A 12: 26,445,522 I325F probably damaging Het
Shank2 T C 7: 144,410,110 V485A probably benign Het
Slc6a5 A G 7: 49,911,726 N2S probably benign Het
Sox4 G T 13: 28,952,930 A31E probably damaging Het
Suv39h2 A T 2: 3,474,414 C2S Het
Tet2 A G 3: 133,485,805 I956T probably benign Het
Topaz1 A G 9: 122,749,465 D480G possibly damaging Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ugt1a6b G T 1: 88,107,098 G53* probably null Het
Vmn1r173 T C 7: 23,702,784 V148A probably damaging Het
Vnn1 G A 10: 23,900,825 C358Y probably damaging Het
Wdr34 G A 2: 30,032,522 A366V possibly damaging Het
Wdr89 A G 12: 75,632,892 V196A probably damaging Het
Wfdc6a T A 2: 164,583,838 D71V possibly damaging Het
Zc3h3 T C 15: 75,839,296 K439E probably damaging Het
Zfp367 T C 13: 64,152,772 H73R probably damaging Het
Zfp955a G A 17: 33,242,133 R342* probably null Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81377905 missense probably benign 0.01
R8022:Gm4787 UTSW 12 81377720 missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81378151 missense probably benign 0.00
R8314:Gm4787 UTSW 12 81379135 missense probably damaging 1.00
R8480:Gm4787 UTSW 12 81377506 missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81377269 missense probably benign 0.00
R9103:Gm4787 UTSW 12 81378715 missense probably benign 0.06
R9457:Gm4787 UTSW 12 81379246 missense probably damaging 1.00
R9608:Gm4787 UTSW 12 81378312 missense probably benign 0.03
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGAGTTTCATGTGGACCAC -3'
(R):5'- CACACAATGCTTGGATGAGC -3'

Sequencing Primer
(F):5'- GACCACATGTCTTTGTCCCCTAAAG -3'
(R):5'- GCAGAGCATTGTTATGTAACAGCCTC -3'
Posted On 2022-08-09