Incidental Mutation 'R9558:Sun1'
ID 720855
Institutional Source Beutler Lab
Gene Symbol Sun1
Ensembl Gene ENSMUSG00000036817
Gene Name Sad1 and UNC84 domain containing 1
Synonyms 4632417G13Rik, 5730434D03Rik, Unc84a
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9558 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 139186392-139235595 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139211019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 91 (T91A)
Ref Sequence ENSEMBL: ENSMUSP00000056655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000100517] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000127045] [ENSMUST00000129079] [ENSMUST00000135720] [ENSMUST00000143562] [ENSMUST00000146715] [ENSMUST00000148772]
AlphaFold Q9D666
Predicted Effect probably benign
Transcript: ENSMUST00000058716
AA Change: T91A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078690
AA Change: T91A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100517
AA Change: T91A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098086
Gene: ENSMUSG00000036817
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110882
AA Change: T91A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110883
AA Change: T91A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110884
AA Change: T91A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127045
SMART Domains Protein: ENSMUSP00000123211
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129079
AA Change: T100A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119582
Gene: ENSMUSG00000036817
AA Change: T100A

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:MRP 71 131 8.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135720
SMART Domains Protein: ENSMUSP00000122785
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
ZnF_C2H2 98 120 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135926
SMART Domains Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
ZnF_C2H2 11 33 5.2e0 SMART
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
coiled coil region 227 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143562
AA Change: T91A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000116364
Gene: ENSMUSG00000036817
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 158 7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146715
AA Change: T91A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117679
Gene: ENSMUSG00000036817
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 160 4.8e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148772
AA Change: T132A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114869
Gene: ENSMUSG00000036817
AA Change: T132A

DomainStartEndE-ValueType
low complexity region 64 76 N/A INTRINSIC
Pfam:MRP 103 176 1.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,290,576 (GRCm39) P126L probably damaging Het
Adh7 T A 3: 137,932,043 (GRCm39) I219N probably damaging Het
Ash1l A G 3: 88,889,521 (GRCm39) S467G probably benign Het
Atm T C 9: 53,412,081 (GRCm39) I992V probably benign Het
Bdnf T C 2: 109,539,999 (GRCm39) V31A Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Ccnk A T 12: 108,155,397 (GRCm39) K118I possibly damaging Het
Ccr2 T A 9: 123,906,104 (GRCm39) V128E possibly damaging Het
Cd163 C A 6: 124,297,471 (GRCm39) N872K probably benign Het
Cd38 A G 5: 44,057,792 (GRCm39) I121M probably damaging Het
Cntnap5c A T 17: 58,671,157 (GRCm39) probably null Het
Cyp11b1 T C 15: 74,710,789 (GRCm39) E257G probably benign Het
Cyp2d40 T C 15: 82,645,667 (GRCm39) T113A unknown Het
Ddx23 A G 15: 98,545,433 (GRCm39) V625A possibly damaging Het
Dnaaf9 T C 2: 130,617,660 (GRCm39) N433D probably damaging Het
Fbxw17 T C 13: 50,577,311 (GRCm39) Y68H probably damaging Het
Fignl1 C T 11: 11,751,778 (GRCm39) V426I possibly damaging Het
Ggn C G 7: 28,871,973 (GRCm39) P487R probably damaging Het
Gjb6 G A 14: 57,362,261 (GRCm39) probably benign Het
Gm5930 A G 14: 44,576,014 (GRCm39) F2L possibly damaging Het
Il1r2 A G 1: 40,162,422 (GRCm39) E355G probably damaging Het
Itprid1 T A 6: 55,944,969 (GRCm39) H563Q possibly damaging Het
Jarid2 C T 13: 45,068,253 (GRCm39) R1092W possibly damaging Het
Lama1 A G 17: 68,124,004 (GRCm39) T2810A Het
Ltn1 A T 16: 87,220,295 (GRCm39) S267R probably benign Het
Mapre2 T A 18: 23,991,195 (GRCm39) H196Q possibly damaging Het
Mfap4 A C 11: 61,376,965 (GRCm39) S65R probably benign Het
Mterf1a C T 5: 3,941,807 (GRCm39) W20* probably null Het
Myh1 C G 11: 67,108,618 (GRCm39) H1345D possibly damaging Het
Myh3 T A 11: 66,983,316 (GRCm39) C948S possibly damaging Het
Ndufa8 A G 2: 35,926,605 (GRCm39) S144P probably benign Het
Nudc G A 4: 133,260,776 (GRCm39) R257C probably benign Het
Nufip1 A G 14: 76,348,481 (GRCm39) M37V probably benign Het
Ogn A G 13: 49,764,783 (GRCm39) E61G probably benign Het
Or52n5 T C 7: 104,588,615 (GRCm39) V294A possibly damaging Het
Pcdh8 A G 14: 80,006,380 (GRCm39) S728P probably damaging Het
Pdzrn4 A G 15: 92,299,877 (GRCm39) D249G possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Setd2 C T 9: 110,376,628 (GRCm39) H148Y probably damaging Het
Smok2b G A 17: 13,453,884 (GRCm39) G15R probably damaging Het
Tbc1d31 G A 15: 57,795,988 (GRCm39) A194T probably damaging Het
Tiparp C T 3: 65,438,852 (GRCm39) S56F possibly damaging Het
Tmf1 C T 6: 97,147,293 (GRCm39) E558K possibly damaging Het
Trip6 A G 5: 137,309,075 (GRCm39) S344P probably benign Het
Ube2q1 A G 3: 89,686,766 (GRCm39) K207E probably benign Het
Ubr2 A G 17: 47,262,843 (GRCm39) V1256A probably benign Het
Vmn1r69 T A 7: 10,314,185 (GRCm39) Y182F probably benign Het
Wipf1 C A 2: 73,268,020 (GRCm39) R126L probably damaging Het
Zc3hav1 T C 6: 38,331,042 (GRCm39) E39G possibly damaging Het
Other mutations in Sun1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Sun1 APN 5 139,220,440 (GRCm39) critical splice acceptor site probably null
IGL01364:Sun1 APN 5 139,220,496 (GRCm39) missense probably damaging 1.00
IGL02142:Sun1 APN 5 139,216,918 (GRCm39) missense possibly damaging 0.95
IGL02251:Sun1 APN 5 139,227,186 (GRCm39) missense probably damaging 1.00
IGL02939:Sun1 APN 5 139,221,243 (GRCm39) splice site probably benign
IGL03253:Sun1 APN 5 139,209,341 (GRCm39) splice site probably benign
IGL03370:Sun1 APN 5 139,216,886 (GRCm39) missense probably damaging 0.96
PIT4418001:Sun1 UTSW 5 139,212,343 (GRCm39) missense probably damaging 0.97
R0124:Sun1 UTSW 5 139,232,434 (GRCm39) unclassified probably benign
R0145:Sun1 UTSW 5 139,227,166 (GRCm39) missense probably damaging 0.98
R0376:Sun1 UTSW 5 139,212,454 (GRCm39) unclassified probably benign
R0512:Sun1 UTSW 5 139,220,602 (GRCm39) splice site probably benign
R0729:Sun1 UTSW 5 139,223,619 (GRCm39) unclassified probably benign
R0733:Sun1 UTSW 5 139,216,918 (GRCm39) missense possibly damaging 0.63
R1188:Sun1 UTSW 5 139,224,611 (GRCm39) missense probably damaging 0.98
R1724:Sun1 UTSW 5 139,221,480 (GRCm39) missense probably benign
R1733:Sun1 UTSW 5 139,216,544 (GRCm39) missense possibly damaging 0.82
R1913:Sun1 UTSW 5 139,221,487 (GRCm39) critical splice donor site probably null
R2033:Sun1 UTSW 5 139,211,193 (GRCm39) missense probably damaging 1.00
R2200:Sun1 UTSW 5 139,216,974 (GRCm39) missense probably benign 0.11
R3084:Sun1 UTSW 5 139,221,356 (GRCm39) missense probably benign 0.41
R3085:Sun1 UTSW 5 139,221,356 (GRCm39) missense probably benign 0.41
R3771:Sun1 UTSW 5 139,224,575 (GRCm39) unclassified probably benign
R3772:Sun1 UTSW 5 139,224,575 (GRCm39) unclassified probably benign
R3804:Sun1 UTSW 5 139,211,117 (GRCm39) nonsense probably null
R4300:Sun1 UTSW 5 139,213,349 (GRCm39) unclassified probably benign
R4428:Sun1 UTSW 5 139,220,230 (GRCm39) intron probably benign
R4993:Sun1 UTSW 5 139,211,088 (GRCm39) missense possibly damaging 0.84
R5075:Sun1 UTSW 5 139,212,646 (GRCm39) splice site probably null
R5363:Sun1 UTSW 5 139,220,498 (GRCm39) missense probably damaging 1.00
R5826:Sun1 UTSW 5 139,231,171 (GRCm39) missense probably damaging 1.00
R6753:Sun1 UTSW 5 139,201,014 (GRCm39) splice site probably null
R7218:Sun1 UTSW 5 139,212,442 (GRCm39) missense unknown
R7320:Sun1 UTSW 5 139,234,239 (GRCm39) missense probably damaging 1.00
R7448:Sun1 UTSW 5 139,232,589 (GRCm39) missense probably damaging 1.00
R7494:Sun1 UTSW 5 139,221,475 (GRCm39) missense probably benign
R8398:Sun1 UTSW 5 139,222,408 (GRCm39) missense probably damaging 1.00
R8756:Sun1 UTSW 5 139,222,444 (GRCm39) missense probably damaging 0.99
R8772:Sun1 UTSW 5 139,209,447 (GRCm39) missense probably benign 0.00
R8804:Sun1 UTSW 5 139,216,920 (GRCm39) missense probably benign 0.05
R8924:Sun1 UTSW 5 139,209,390 (GRCm39) missense probably damaging 1.00
R9124:Sun1 UTSW 5 139,231,121 (GRCm39) nonsense probably null
R9169:Sun1 UTSW 5 139,219,273 (GRCm39) missense probably benign 0.33
R9262:Sun1 UTSW 5 139,200,918 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGTTGTCAGGCCCAGAATAGTC -3'
(R):5'- TTTGGTCTGCTCACGAATCAG -3'

Sequencing Primer
(F):5'- GATTGTACCAGACACAGCA -3'
(R):5'- TCAGGGACTCATCTAGCACAGG -3'
Posted On 2022-08-09