Incidental Mutation 'R9558:Cd163'
ID 720859
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene Name CD163 antigen
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9558 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124281615-124307486 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 124297471 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 872 (N872K)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
AlphaFold Q2VLH6
Predicted Effect probably benign
Transcript: ENSMUST00000032234
AA Change: N872K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: N872K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112541
AA Change: N872K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: N872K

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,290,576 (GRCm39) P126L probably damaging Het
Adh7 T A 3: 137,932,043 (GRCm39) I219N probably damaging Het
Ash1l A G 3: 88,889,521 (GRCm39) S467G probably benign Het
Atm T C 9: 53,412,081 (GRCm39) I992V probably benign Het
Bdnf T C 2: 109,539,999 (GRCm39) V31A Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,128,173 (GRCm39) probably benign Het
Ccnk A T 12: 108,155,397 (GRCm39) K118I possibly damaging Het
Ccr2 T A 9: 123,906,104 (GRCm39) V128E possibly damaging Het
Cd38 A G 5: 44,057,792 (GRCm39) I121M probably damaging Het
Cntnap5c A T 17: 58,671,157 (GRCm39) probably null Het
Cyp11b1 T C 15: 74,710,789 (GRCm39) E257G probably benign Het
Cyp2d40 T C 15: 82,645,667 (GRCm39) T113A unknown Het
Ddx23 A G 15: 98,545,433 (GRCm39) V625A possibly damaging Het
Dnaaf9 T C 2: 130,617,660 (GRCm39) N433D probably damaging Het
Fbxw17 T C 13: 50,577,311 (GRCm39) Y68H probably damaging Het
Fignl1 C T 11: 11,751,778 (GRCm39) V426I possibly damaging Het
Ggn C G 7: 28,871,973 (GRCm39) P487R probably damaging Het
Gjb6 G A 14: 57,362,261 (GRCm39) probably benign Het
Gm5930 A G 14: 44,576,014 (GRCm39) F2L possibly damaging Het
Il1r2 A G 1: 40,162,422 (GRCm39) E355G probably damaging Het
Itprid1 T A 6: 55,944,969 (GRCm39) H563Q possibly damaging Het
Jarid2 C T 13: 45,068,253 (GRCm39) R1092W possibly damaging Het
Lama1 A G 17: 68,124,004 (GRCm39) T2810A Het
Ltn1 A T 16: 87,220,295 (GRCm39) S267R probably benign Het
Mapre2 T A 18: 23,991,195 (GRCm39) H196Q possibly damaging Het
Mfap4 A C 11: 61,376,965 (GRCm39) S65R probably benign Het
Mterf1a C T 5: 3,941,807 (GRCm39) W20* probably null Het
Myh1 C G 11: 67,108,618 (GRCm39) H1345D possibly damaging Het
Myh3 T A 11: 66,983,316 (GRCm39) C948S possibly damaging Het
Ndufa8 A G 2: 35,926,605 (GRCm39) S144P probably benign Het
Nudc G A 4: 133,260,776 (GRCm39) R257C probably benign Het
Nufip1 A G 14: 76,348,481 (GRCm39) M37V probably benign Het
Ogn A G 13: 49,764,783 (GRCm39) E61G probably benign Het
Or52n5 T C 7: 104,588,615 (GRCm39) V294A possibly damaging Het
Pcdh8 A G 14: 80,006,380 (GRCm39) S728P probably damaging Het
Pdzrn4 A G 15: 92,299,877 (GRCm39) D249G possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Setd2 C T 9: 110,376,628 (GRCm39) H148Y probably damaging Het
Smok2b G A 17: 13,453,884 (GRCm39) G15R probably damaging Het
Sun1 A G 5: 139,211,019 (GRCm39) T91A probably benign Het
Tbc1d31 G A 15: 57,795,988 (GRCm39) A194T probably damaging Het
Tiparp C T 3: 65,438,852 (GRCm39) S56F possibly damaging Het
Tmf1 C T 6: 97,147,293 (GRCm39) E558K possibly damaging Het
Trip6 A G 5: 137,309,075 (GRCm39) S344P probably benign Het
Ube2q1 A G 3: 89,686,766 (GRCm39) K207E probably benign Het
Ubr2 A G 17: 47,262,843 (GRCm39) V1256A probably benign Het
Vmn1r69 T A 7: 10,314,185 (GRCm39) Y182F probably benign Het
Wipf1 C A 2: 73,268,020 (GRCm39) R126L probably damaging Het
Zc3hav1 T C 6: 38,331,042 (GRCm39) E39G possibly damaging Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124,306,060 (GRCm39) splice site probably benign
IGL00755:Cd163 APN 6 124,295,616 (GRCm39) missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124,284,277 (GRCm39) missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124,284,246 (GRCm39) nonsense probably null
IGL02733:Cd163 APN 6 124,302,300 (GRCm39) missense probably damaging 1.00
IGL02801:Cd163 APN 6 124,297,488 (GRCm39) missense probably benign 0.00
IGL02897:Cd163 APN 6 124,302,486 (GRCm39) missense probably damaging 1.00
IGL03074:Cd163 APN 6 124,294,945 (GRCm39) missense probably benign 0.00
IGL03283:Cd163 APN 6 124,286,158 (GRCm39) missense possibly damaging 0.49
compass UTSW 6 124,306,045 (GRCm39) makesense probably null
hottish UTSW 6 124,286,167 (GRCm39) missense probably damaging 1.00
protractor UTSW 6 124,288,525 (GRCm39) missense probably damaging 1.00
t-square UTSW 6 124,302,247 (GRCm39) missense probably damaging 0.97
R0494:Cd163 UTSW 6 124,288,408 (GRCm39) missense probably damaging 1.00
R0554:Cd163 UTSW 6 124,289,619 (GRCm39) missense probably benign 0.03
R0622:Cd163 UTSW 6 124,294,311 (GRCm39) missense probably damaging 1.00
R1004:Cd163 UTSW 6 124,302,306 (GRCm39) missense probably damaging 1.00
R1061:Cd163 UTSW 6 124,286,128 (GRCm39) missense probably benign 0.00
R1132:Cd163 UTSW 6 124,286,055 (GRCm39) nonsense probably null
R1195:Cd163 UTSW 6 124,302,209 (GRCm39) splice site probably benign
R1195:Cd163 UTSW 6 124,302,209 (GRCm39) splice site probably benign
R1436:Cd163 UTSW 6 124,304,890 (GRCm39) missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124,288,406 (GRCm39) missense probably damaging 1.00
R1532:Cd163 UTSW 6 124,289,689 (GRCm39) missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124,304,920 (GRCm39) missense probably benign
R1654:Cd163 UTSW 6 124,294,540 (GRCm39) missense probably damaging 1.00
R1717:Cd163 UTSW 6 124,306,547 (GRCm39) utr 3 prime probably benign
R1744:Cd163 UTSW 6 124,283,987 (GRCm39) missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124,302,457 (GRCm39) missense probably damaging 0.99
R2035:Cd163 UTSW 6 124,297,588 (GRCm39) missense probably damaging 0.97
R2095:Cd163 UTSW 6 124,294,781 (GRCm39) missense probably damaging 1.00
R2124:Cd163 UTSW 6 124,295,815 (GRCm39) missense probably damaging 1.00
R2146:Cd163 UTSW 6 124,286,167 (GRCm39) missense probably damaging 1.00
R2353:Cd163 UTSW 6 124,296,115 (GRCm39) nonsense probably null
R3854:Cd163 UTSW 6 124,288,525 (GRCm39) missense probably damaging 1.00
R4425:Cd163 UTSW 6 124,304,862 (GRCm39) missense possibly damaging 0.94
R4631:Cd163 UTSW 6 124,306,045 (GRCm39) makesense probably null
R4647:Cd163 UTSW 6 124,297,580 (GRCm39) missense probably damaging 1.00
R4713:Cd163 UTSW 6 124,294,577 (GRCm39) critical splice donor site probably null
R4803:Cd163 UTSW 6 124,289,389 (GRCm39) missense probably damaging 0.99
R4996:Cd163 UTSW 6 124,296,106 (GRCm39) missense probably benign 0.00
R5022:Cd163 UTSW 6 124,302,247 (GRCm39) missense probably damaging 0.97
R5023:Cd163 UTSW 6 124,302,247 (GRCm39) missense probably damaging 0.97
R5032:Cd163 UTSW 6 124,288,628 (GRCm39) missense probably damaging 1.00
R5057:Cd163 UTSW 6 124,302,247 (GRCm39) missense probably damaging 0.97
R5121:Cd163 UTSW 6 124,294,948 (GRCm39) missense probably damaging 1.00
R5436:Cd163 UTSW 6 124,304,923 (GRCm39) missense probably benign
R5453:Cd163 UTSW 6 124,289,500 (GRCm39) missense probably damaging 1.00
R5723:Cd163 UTSW 6 124,296,022 (GRCm39) missense probably benign 0.00
R5929:Cd163 UTSW 6 124,303,568 (GRCm39) critical splice donor site probably null
R5943:Cd163 UTSW 6 124,306,561 (GRCm39) makesense probably null
R5964:Cd163 UTSW 6 124,303,531 (GRCm39) missense probably benign 0.01
R5966:Cd163 UTSW 6 124,297,595 (GRCm39) nonsense probably null
R6279:Cd163 UTSW 6 124,294,950 (GRCm39) nonsense probably null
R6300:Cd163 UTSW 6 124,294,950 (GRCm39) nonsense probably null
R6499:Cd163 UTSW 6 124,281,703 (GRCm39) missense probably benign 0.00
R6602:Cd163 UTSW 6 124,288,594 (GRCm39) missense probably damaging 1.00
R6708:Cd163 UTSW 6 124,286,167 (GRCm39) missense probably damaging 1.00
R6767:Cd163 UTSW 6 124,281,738 (GRCm39) missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124,294,945 (GRCm39) missense probably benign 0.00
R6993:Cd163 UTSW 6 124,294,673 (GRCm39) missense probably damaging 1.00
R7345:Cd163 UTSW 6 124,295,897 (GRCm39) missense possibly damaging 0.52
R7382:Cd163 UTSW 6 124,288,271 (GRCm39) splice site probably null
R7552:Cd163 UTSW 6 124,284,187 (GRCm39) missense probably benign 0.08
R7829:Cd163 UTSW 6 124,281,738 (GRCm39) missense probably benign 0.04
R8354:Cd163 UTSW 6 124,305,924 (GRCm39) missense probably benign 0.43
R8454:Cd163 UTSW 6 124,305,924 (GRCm39) missense probably benign 0.43
R8530:Cd163 UTSW 6 124,295,860 (GRCm39) missense probably damaging 1.00
R8560:Cd163 UTSW 6 124,294,360 (GRCm39) missense possibly damaging 0.86
R8878:Cd163 UTSW 6 124,297,469 (GRCm39) missense probably damaging 0.99
R8930:Cd163 UTSW 6 124,294,882 (GRCm39) missense probably damaging 1.00
R8932:Cd163 UTSW 6 124,294,882 (GRCm39) missense probably damaging 1.00
R9074:Cd163 UTSW 6 124,285,947 (GRCm39) nonsense probably null
R9408:Cd163 UTSW 6 124,297,497 (GRCm39) missense probably benign 0.39
R9530:Cd163 UTSW 6 124,294,491 (GRCm39) nonsense probably null
R9608:Cd163 UTSW 6 124,286,163 (GRCm39) missense possibly damaging 0.79
R9685:Cd163 UTSW 6 124,288,384 (GRCm39) missense possibly damaging 0.77
Z1177:Cd163 UTSW 6 124,294,344 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CTAATGAGTTTCTAGGAGTTGACAC -3'
(R):5'- CTGTCACAGATGATCCAGGAC -3'

Sequencing Primer
(F):5'- CTGTTACATCCGTTTCTAAGTTAGAG -3'
(R):5'- GTCACAGATGATCCAGGACTCCTG -3'
Posted On 2022-08-09