Incidental Mutation 'R9559:C130073F10Rik'
ID 720902
Institutional Source Beutler Lab
Gene Symbol C130073F10Rik
Ensembl Gene ENSMUSG00000046133
Gene Name RIKEN cDNA C130073F10 gene
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R9559 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 101747217-101750986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 101747946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 76 (Y76F)
Ref Sequence ENSEMBL: ENSMUSP00000059092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051043]
AlphaFold Q8C4L8
Predicted Effect possibly damaging
Transcript: ENSMUST00000051043
AA Change: Y76F

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,021,019 (GRCm39) probably null Het
Ahnak2 C T 12: 112,749,782 (GRCm39) probably null Het
Arhgef37 A T 18: 61,640,267 (GRCm39) probably null Het
Asb14 T C 14: 26,637,052 (GRCm39) V598A possibly damaging Het
Baz1b T A 5: 135,216,532 (GRCm39) F10Y probably benign Het
Bbc3 T C 7: 16,047,660 (GRCm39) V128A probably benign Het
Cdc42bpa G A 1: 179,939,459 (GRCm39) probably null Het
Cfh G T 1: 140,030,275 (GRCm39) P884Q probably benign Het
Cltc T C 11: 86,613,086 (GRCm39) Y479C probably damaging Het
Col18a1 C T 10: 76,913,630 (GRCm39) G477E probably damaging Het
Col7a1 A G 9: 108,786,360 (GRCm39) N530S unknown Het
Csmd2 G T 4: 128,438,561 (GRCm39) G3047C Het
Cyb5r3 C A 15: 83,043,123 (GRCm39) E190* probably null Het
Dnah3 A T 7: 119,650,951 (GRCm39) V983D probably benign Het
Fcer1a T G 1: 173,052,884 (GRCm39) Y104S possibly damaging Het
Fer1l6 A G 15: 58,429,759 (GRCm39) T169A possibly damaging Het
Gimap9 A T 6: 48,655,134 (GRCm39) K240N probably benign Het
Gmeb1 A C 4: 131,953,140 (GRCm39) V542G probably benign Het
Grb10 C A 11: 11,895,535 (GRCm39) R318L probably damaging Het
Gucy1b1 T A 3: 81,947,054 (GRCm39) D385V possibly damaging Het
Hdgfl1 C T 13: 26,953,239 (GRCm39) G278E probably damaging Het
Il18r1 T A 1: 40,528,793 (GRCm39) I279K probably benign Het
Il21r A G 7: 125,232,027 (GRCm39) D485G probably damaging Het
Jarid2 C T 13: 45,068,253 (GRCm39) R1092W possibly damaging Het
Kdm4b T C 17: 56,693,228 (GRCm39) L355P probably damaging Het
Kif26a C T 12: 112,142,004 (GRCm39) R753W probably damaging Het
Krtcap2 C T 3: 89,154,178 (GRCm39) T33I probably damaging Het
Mettl17 G A 14: 52,129,009 (GRCm39) probably null Het
Mov10 A G 3: 104,708,277 (GRCm39) F491L Het
Mterf1a C T 5: 3,941,807 (GRCm39) W20* probably null Het
Nck2 T C 1: 43,593,207 (GRCm39) V138A probably damaging Het
Or2h2c C T 17: 37,422,509 (GRCm39) V122M possibly damaging Het
Or5ac24 C A 16: 59,165,368 (GRCm39) G232V probably damaging Het
Or5ak24 A C 2: 85,260,753 (GRCm39) V140G possibly damaging Het
Or7e173 A G 9: 19,939,216 (GRCm39) V6A probably benign Het
Osmr A G 15: 6,882,027 (GRCm39) V39A probably damaging Het
Plekhh2 A G 17: 84,899,017 (GRCm39) H998R probably damaging Het
Prb1a G A 6: 132,184,388 (GRCm39) S415F unknown Het
Prl3d1 C T 13: 27,280,470 (GRCm39) T73I probably benign Het
Scgn A G 13: 24,137,921 (GRCm39) L250P probably damaging Het
Scyl3 T C 1: 163,779,773 (GRCm39) I580T probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Shank2 A T 7: 143,585,041 (GRCm39) Q14L probably benign Het
Slc22a12 T A 19: 6,587,686 (GRCm39) N423Y probably damaging Het
Tenm4 T A 7: 96,473,056 (GRCm39) S951T probably benign Het
Ubash3b G A 9: 40,954,926 (GRCm39) P195S probably damaging Het
Vmn1r61 A G 7: 5,613,498 (GRCm39) F272S probably damaging Het
Zbtb41 A T 1: 139,358,053 (GRCm39) I454F probably benign Het
Zfp112 G T 7: 23,826,108 (GRCm39) C696F probably damaging Het
Other mutations in C130073F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02805:C130073F10Rik APN 4 101,748,171 (GRCm39) start codon destroyed probably null 1.00
IGL02869:C130073F10Rik APN 4 101,747,590 (GRCm39) nonsense probably null
R0621:C130073F10Rik UTSW 4 101,747,992 (GRCm39) missense probably damaging 1.00
R1368:C130073F10Rik UTSW 4 101,747,953 (GRCm39) missense possibly damaging 0.78
R1471:C130073F10Rik UTSW 4 101,747,535 (GRCm39) missense probably benign 0.01
R4732:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R4733:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R5372:C130073F10Rik UTSW 4 101,747,684 (GRCm39) missense probably damaging 1.00
R5777:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R6510:C130073F10Rik UTSW 4 101,747,482 (GRCm39) missense probably benign 0.01
R6888:C130073F10Rik UTSW 4 101,747,453 (GRCm39) missense probably benign 0.12
R7229:C130073F10Rik UTSW 4 101,747,439 (GRCm39) missense probably benign 0.00
R8186:C130073F10Rik UTSW 4 101,748,031 (GRCm39) nonsense probably null
R8353:C130073F10Rik UTSW 4 101,747,881 (GRCm39) splice site probably null
R8857:C130073F10Rik UTSW 4 101,747,555 (GRCm39) missense possibly damaging 0.52
R9590:C130073F10Rik UTSW 4 101,747,618 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACCTCCTGTGGGTCAAACAG -3'
(R):5'- GCACCTGACGATCCAGTTTC -3'

Sequencing Primer
(F):5'- CTGTGGGTCAAACAGGAAGGC -3'
(R):5'- CTGCTGAATCATGAAGACTTGGC -3'
Posted On 2022-08-09