Incidental Mutation 'R9559:Fer1l6'
ID 720933
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9559 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58557910 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 169 (T169A)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect possibly damaging
Transcript: ENSMUST00000161028
AA Change: T169A

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: T169A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,421,796 probably null Het
Ahnak2 C T 12: 112,786,162 probably null Het
Arhgef37 A T 18: 61,507,196 probably null Het
Asb14 T C 14: 26,915,095 V598A possibly damaging Het
Baz1b T A 5: 135,187,678 F10Y probably benign Het
Bbc3 T C 7: 16,313,735 V128A probably benign Het
C130073F10Rik T A 4: 101,890,749 Y76F possibly damaging Het
Cdc42bpa G A 1: 180,111,894 probably null Het
Cfh G T 1: 140,102,537 P884Q probably benign Het
Cltc T C 11: 86,722,260 Y479C probably damaging Het
Col18a1 C T 10: 77,077,796 G477E probably damaging Het
Col7a1 A G 9: 108,957,292 N530S unknown Het
Csmd2 G T 4: 128,544,768 G3047C Het
Cyb5r3 C A 15: 83,158,922 E190* probably null Het
Dnah3 A T 7: 120,051,728 V983D probably benign Het
Fcer1a T G 1: 173,225,317 Y104S possibly damaging Het
Gimap9 A T 6: 48,678,200 K240N probably benign Het
Gmeb1 A C 4: 132,225,829 V542G probably benign Het
Grb10 C A 11: 11,945,535 R318L probably damaging Het
Gucy1b1 T A 3: 82,039,747 D385V possibly damaging Het
Hdgfl1 C T 13: 26,769,256 G278E probably damaging Het
Il18r1 T A 1: 40,489,633 I279K probably benign Het
Il21r A G 7: 125,632,855 D485G probably damaging Het
Jarid2 C T 13: 44,914,777 R1092W possibly damaging Het
Kdm4b T C 17: 56,386,228 L355P probably damaging Het
Kif26a C T 12: 112,175,570 R753W probably damaging Het
Krtcap2 C T 3: 89,246,871 T33I probably damaging Het
Mettl17 G A 14: 51,891,552 probably null Het
Mov10 A G 3: 104,800,961 F491L Het
Mterf1a C T 5: 3,891,807 W20* probably null Het
Nck2 T C 1: 43,554,047 V138A probably damaging Het
Olfr206 C A 16: 59,345,005 G232V probably damaging Het
Olfr866 A G 9: 20,027,920 V6A probably benign Het
Olfr92 C T 17: 37,111,617 V122M possibly damaging Het
Olfr994 A C 2: 85,430,409 V140G possibly damaging Het
Osmr A G 15: 6,852,546 V39A probably damaging Het
Plekhh2 A G 17: 84,591,589 H998R probably damaging Het
Prb1 G A 6: 132,207,425 S415F unknown Het
Prl3d1 C T 13: 27,096,487 T73I probably benign Het
Scgn A G 13: 23,953,938 L250P probably damaging Het
Scyl3 T C 1: 163,952,204 I580T probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Shank2 A T 7: 144,031,304 Q14L probably benign Het
Slc22a12 T A 19: 6,537,656 N423Y probably damaging Het
Tenm4 T A 7: 96,823,849 S951T probably benign Het
Ubash3b G A 9: 41,043,630 P195S probably damaging Het
Vmn1r61 A G 7: 5,610,499 F272S probably damaging Het
Zbtb41 A T 1: 139,430,315 I454F probably benign Het
Zfp112 G T 7: 24,126,683 C696F probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGCTCCAGACAAGGTC -3'
(R):5'- GTAGACATCCCCAGTCCTTTGG -3'

Sequencing Primer
(F):5'- TCTGCTCCAGACAAGGTCAAACC -3'
(R):5'- GACATCCCCAGTCCTTTGGCTATC -3'
Posted On 2022-08-09