Incidental Mutation 'R9560:Cdh19'
ID 720944
Institutional Source Beutler Lab
Gene Symbol Cdh19
Ensembl Gene ENSMUSG00000047216
Gene Name cadherin 19, type 2
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9560 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 110888326-110977584 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110893274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 578 (E578V)
Ref Sequence ENSEMBL: ENSMUSP00000092210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094626]
AlphaFold E9Q3A7
Predicted Effect possibly damaging
Transcript: ENSMUST00000094626
AA Change: E578V

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092210
Gene: ENSMUSG00000047216
AA Change: E578V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 64 144 2.44e-14 SMART
CA 168 252 3.21e-23 SMART
CA 276 367 6.2e-7 SMART
CA 390 466 2.69e-16 SMART
CA 489 576 6.68e-3 SMART
transmembrane domain 594 616 N/A INTRINSIC
Pfam:Cadherin_C 619 764 1.7e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related type II cadherin genes situated in a cluster on chromosome 18. The encoded protein is a calcium dependent cell-cell adhesion glycoprotein containing five extracellular cadherin repeats. Loss of cadherins may be associated with cancer formation. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,948,255 R502G probably damaging Het
A930004D18Rik G A 2: 18,027,407 probably benign Het
Abhd16b T A 2: 181,493,310 C2S probably damaging Het
Adam2 T C 14: 66,037,653 M544V probably benign Het
AF529169 G T 9: 89,602,478 Q289K probably benign Het
Agbl3 T A 6: 34,846,908 V841E possibly damaging Het
Aldh1l1 A G 6: 90,559,843 D127G probably damaging Het
Ap1b1 G A 11: 5,026,363 E464K probably benign Het
BC051142 A T 17: 34,444,042 Q103H probably damaging Het
Chat G A 14: 32,448,985 Q186* probably null Het
Cited4 A G 4: 120,666,968 T56A probably benign Het
Cpt1a T C 19: 3,352,531 L63P possibly damaging Het
Gm3139 A T 5: 94,537,781 R433S possibly damaging Het
Havcr2 C A 11: 46,456,337 A47E probably benign Het
Hdgfl1 C T 13: 26,769,256 G278E probably damaging Het
Klf5 A T 14: 99,301,598 Q149L probably benign Het
Klk10 A G 7: 43,784,322 Y186C probably damaging Het
Krt79 C T 15: 101,937,842 E224K probably damaging Het
Llgl2 A G 11: 115,834,856 D10G probably damaging Het
Lrrc37a C T 11: 103,456,594 V3092I unknown Het
Nbeal1 A G 1: 60,329,385 T2630A probably damaging Het
Ncor1 T C 11: 62,373,122 T485A possibly damaging Het
Olfr1199 A C 2: 88,755,946 I243S possibly damaging Het
Olfr1564 G A 17: 33,216,012 H111Y probably damaging Het
Olfr55 C T 17: 33,176,894 T164M probably damaging Het
Olfr908 G A 9: 38,516,089 S19N probably benign Het
Patj G A 4: 98,682,052 E1705K probably benign Het
Pcdh17 T A 14: 84,533,458 D1125E probably benign Het
Pfpl G C 19: 12,428,933 E183Q probably damaging Het
Pnliprp2 T C 19: 58,774,091 V376A possibly damaging Het
Scn1a A T 2: 66,327,787 L414Q probably damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Slc22a23 A G 13: 34,197,868 V411A possibly damaging Het
Slco1c1 T C 6: 141,569,350 V657A probably benign Het
Slco3a1 A T 7: 74,504,183 Y214N probably damaging Het
Sned1 A G 1: 93,274,388 T633A probably damaging Het
Tmem175 T C 5: 108,641,827 F96S probably damaging Het
Tmf1 C T 6: 97,170,332 E558K possibly damaging Het
Ubac2 G A 14: 121,908,224 G98D possibly damaging Het
Unc50 T A 1: 37,437,167 V136D possibly damaging Het
Vmn1r49 T A 6: 90,072,400 M207L probably benign Het
Zfp853 T C 5: 143,289,325 E195G unknown Het
Zfyve9 A T 4: 108,718,137 N582K possibly damaging Het
Other mutations in Cdh19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Cdh19 APN 1 110949252 missense probably damaging 1.00
IGL00863:Cdh19 APN 1 110949144 missense probably damaging 1.00
IGL01537:Cdh19 APN 1 110919611 missense possibly damaging 0.73
IGL02108:Cdh19 APN 1 110889731 missense probably benign 0.31
IGL02125:Cdh19 APN 1 110929884 missense possibly damaging 0.94
IGL02234:Cdh19 APN 1 110932226 missense probably damaging 1.00
IGL02251:Cdh19 APN 1 110954652 missense probably benign 0.00
IGL02275:Cdh19 APN 1 110925886 missense probably benign 0.21
IGL03203:Cdh19 APN 1 110890098 missense possibly damaging 0.82
R0539:Cdh19 UTSW 1 110925162 missense possibly damaging 0.81
R0594:Cdh19 UTSW 1 110925867 missense probably benign 0.40
R0612:Cdh19 UTSW 1 110893170 splice site probably benign
R1028:Cdh19 UTSW 1 110954584 missense probably benign 0.03
R1627:Cdh19 UTSW 1 110919645 missense probably benign 0.16
R1728:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1729:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1730:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1739:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1762:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1783:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1785:Cdh19 UTSW 1 110893384 missense probably damaging 0.98
R1974:Cdh19 UTSW 1 110890159 missense possibly damaging 0.50
R2119:Cdh19 UTSW 1 110919590 missense probably benign 0.00
R3026:Cdh19 UTSW 1 110954688 missense probably benign 0.03
R3037:Cdh19 UTSW 1 110954607 missense probably damaging 1.00
R3612:Cdh19 UTSW 1 110893296 missense probably damaging 1.00
R4254:Cdh19 UTSW 1 110925030 missense probably damaging 1.00
R4368:Cdh19 UTSW 1 110889712 nonsense probably null
R4624:Cdh19 UTSW 1 110932251 missense probably benign 0.25
R4648:Cdh19 UTSW 1 110925177 missense probably benign 0.04
R4720:Cdh19 UTSW 1 110895381 critical splice donor site probably null
R4766:Cdh19 UTSW 1 110893260 missense probably benign 0.39
R4937:Cdh19 UTSW 1 110889964 missense probably damaging 1.00
R4968:Cdh19 UTSW 1 110925228 missense probably benign 0.08
R4970:Cdh19 UTSW 1 110954624 missense possibly damaging 0.68
R5095:Cdh19 UTSW 1 110954661 missense probably benign
R5112:Cdh19 UTSW 1 110954624 missense possibly damaging 0.68
R5586:Cdh19 UTSW 1 110929857 missense probably damaging 1.00
R6431:Cdh19 UTSW 1 110925057 missense probably benign 0.00
R6595:Cdh19 UTSW 1 110925787 missense probably benign 0.15
R6997:Cdh19 UTSW 1 110954866 start gained probably benign
R7240:Cdh19 UTSW 1 110893407 missense probably benign
R8252:Cdh19 UTSW 1 110889885 missense probably benign 0.00
R8299:Cdh19 UTSW 1 110919548 missense probably benign 0.01
R8416:Cdh19 UTSW 1 110925880 missense probably benign 0.13
R8766:Cdh19 UTSW 1 110890114 missense probably benign 0.33
R9090:Cdh19 UTSW 1 110949217 missense probably damaging 1.00
R9177:Cdh19 UTSW 1 110949381 missense probably damaging 1.00
R9266:Cdh19 UTSW 1 110890041 missense probably damaging 1.00
R9268:Cdh19 UTSW 1 110949381 missense probably damaging 1.00
R9271:Cdh19 UTSW 1 110949217 missense probably damaging 1.00
R9533:Cdh19 UTSW 1 110889859 missense probably damaging 1.00
R9765:Cdh19 UTSW 1 110895381 critical splice donor site probably null
Z1176:Cdh19 UTSW 1 110893306 missense probably benign 0.00
Z1176:Cdh19 UTSW 1 110895387 missense probably damaging 1.00
Z1176:Cdh19 UTSW 1 110932214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGATACTGTACTACAAAGAAGCTG -3'
(R):5'- TGGTTTCTGTTTTAGATAACACAGC -3'

Sequencing Primer
(F):5'- AGAGTTCTCGAGGTCAATTCCCAG -3'
(R):5'- GCTGTAATTCTGAGTAATAGAACTGG -3'
Posted On 2022-08-09