Mutagenetix > Incidental Mutation

Incidental Mutation 'R9560:Slc22a23'

720972

Institutional Source

Beutler Lab

Gene Symbol

Slc22a23

Ensembl Gene

ENSMUSG00000038267

Gene Name

solute carrier family 22, member 23

Synonyms

3110004L20Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R9560 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34179158-34345182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34197868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 411 (V411A)

Ref Sequence

ENSEMBL: ENSMUSP00000042742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040336]

AlphaFold

Q3UHH2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040336
AA Change: V411A

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: V411A

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
low complexity region	153	164	N/A	INTRINSIC
Pfam:Sugar_tr	187	633	5e-26	PFAM
Pfam:MFS_1	224	518	2.6e-13	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: V295A

Domain	Start	End	E-Value	Type
low complexity region	38	49	N/A	INTRINSIC
Pfam:Sugar_tr	71	510	1.4e-27	PFAM
Pfam:MFS_1	109	402	1.5e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	T	C	11: 48,948,255	R502G	probably damaging	Het
A930004D18Rik	G	A	2: 18,027,407		probably benign	Het
Abhd16b	T	A	2: 181,493,310	C2S	probably damaging	Het
Adam2	T	C	14: 66,037,653	M544V	probably benign	Het
AF529169	G	T	9: 89,602,478	Q289K	probably benign	Het
Agbl3	T	A	6: 34,846,908	V841E	possibly damaging	Het
Aldh1l1	A	G	6: 90,559,843	D127G	probably damaging	Het
Ap1b1	G	A	11: 5,026,363	E464K	probably benign	Het
BC051142	A	T	17: 34,444,042	Q103H	probably damaging	Het
Cdh19	T	A	1: 110,893,274	E578V	possibly damaging	Het
Chat	G	A	14: 32,448,985	Q186*	probably null	Het
Cited4	A	G	4: 120,666,968	T56A	probably benign	Het
Cpt1a	T	C	19: 3,352,531	L63P	possibly damaging	Het
Gm3139	A	T	5: 94,537,781	R433S	possibly damaging	Het
Havcr2	C	A	11: 46,456,337	A47E	probably benign	Het
Hdgfl1	C	T	13: 26,769,256	G278E	probably damaging	Het
Klf5	A	T	14: 99,301,598	Q149L	probably benign	Het
Klk10	A	G	7: 43,784,322	Y186C	probably damaging	Het
Krt79	C	T	15: 101,937,842	E224K	probably damaging	Het
Llgl2	A	G	11: 115,834,856	D10G	probably damaging	Het
Lrrc37a	C	T	11: 103,456,594	V3092I	unknown	Het
Nbeal1	A	G	1: 60,329,385	T2630A	probably damaging	Het
Ncor1	T	C	11: 62,373,122	T485A	possibly damaging	Het
Olfr1199	A	C	2: 88,755,946	I243S	possibly damaging	Het
Olfr1564	G	A	17: 33,216,012	H111Y	probably damaging	Het
Olfr55	C	T	17: 33,176,894	T164M	probably damaging	Het
Olfr908	G	A	9: 38,516,089	S19N	probably benign	Het
Patj	G	A	4: 98,682,052	E1705K	probably benign	Het
Pcdh17	T	A	14: 84,533,458	D1125E	probably benign	Het
Pfpl	G	C	19: 12,428,933	E183Q	probably damaging	Het
Pnliprp2	T	C	19: 58,774,091	V376A	possibly damaging	Het
Scn1a	A	T	2: 66,327,787	L414Q	probably damaging	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Slco1c1	T	C	6: 141,569,350	V657A	probably benign	Het
Slco3a1	A	T	7: 74,504,183	Y214N	probably damaging	Het
Sned1	A	G	1: 93,274,388	T633A	probably damaging	Het
Tmem175	T	C	5: 108,641,827	F96S	probably damaging	Het
Tmf1	C	T	6: 97,170,332	E558K	possibly damaging	Het
Ubac2	G	A	14: 121,908,224	G98D	possibly damaging	Het
Unc50	T	A	1: 37,437,167	V136D	possibly damaging	Het
Vmn1r49	T	A	6: 90,072,400	M207L	probably benign	Het
Zfp853	T	C	5: 143,289,325	E195G	unknown	Het
Zfyve9	A	T	4: 108,718,137	N582K	possibly damaging	Het

Other mutations in Slc22a23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Slc22a23	APN	13	34305245	missense	probably damaging	1.00
IGL01762:Slc22a23	APN	13	34204001	missense	possibly damaging	0.71
IGL02496:Slc22a23	APN	13	34344485	missense	possibly damaging	0.93
IGL02516:Slc22a23	APN	13	34203955	missense	probably benign	0.02
IGL02831:Slc22a23	APN	13	34299069	missense	possibly damaging	0.81
Foreshadowed	UTSW	13	34195479	missense	probably damaging	0.98
foretold	UTSW	13	34305180	missense	probably benign	0.08
BB009:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
BB019:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
R0234:Slc22a23	UTSW	13	34183261	missense	probably damaging	1.00
R0234:Slc22a23	UTSW	13	34183261	missense	probably damaging	1.00
R0413:Slc22a23	UTSW	13	34183132	missense	probably damaging	1.00
R0557:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0558:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0636:Slc22a23	UTSW	13	34299093	missense	probably benign	0.01
R0676:Slc22a23	UTSW	13	34195479	missense	probably damaging	0.98
R0739:Slc22a23	UTSW	13	34344383	missense	possibly damaging	0.50
R0990:Slc22a23	UTSW	13	34195467	missense	probably damaging	1.00
R1515:Slc22a23	UTSW	13	34203964	missense	probably benign	0.33
R2128:Slc22a23	UTSW	13	34203970	missense	possibly damaging	0.76
R2147:Slc22a23	UTSW	13	34183007	missense	probably benign	0.00
R3113:Slc22a23	UTSW	13	34183075	missense	probably damaging	0.98
R3780:Slc22a23	UTSW	13	34344340	missense	probably benign	0.14
R3945:Slc22a23	UTSW	13	34183126	missense	probably damaging	0.98
R3946:Slc22a23	UTSW	13	34183126	missense	probably damaging	0.98
R4056:Slc22a23	UTSW	13	34299004	nonsense	probably null
R4095:Slc22a23	UTSW	13	34305206	missense	probably damaging	1.00
R4854:Slc22a23	UTSW	13	34203941	missense	probably benign
R5594:Slc22a23	UTSW	13	34305257	missense	probably damaging	0.99
R5611:Slc22a23	UTSW	13	34305239	missense	probably benign	0.00
R6167:Slc22a23	UTSW	13	34344559	missense	probably damaging	0.97
R6927:Slc22a23	UTSW	13	34344379	missense	probably benign	0.07
R6933:Slc22a23	UTSW	13	34305180	missense	probably benign	0.08
R6960:Slc22a23	UTSW	13	34344157	critical splice donor site	probably null
R7291:Slc22a23	UTSW	13	34197839	missense	probably damaging	0.99
R7313:Slc22a23	UTSW	13	34183178	missense	probably damaging	1.00
R7932:Slc22a23	UTSW	13	34182977	missense	probably damaging	0.99
R8058:Slc22a23	UTSW	13	34305184	nonsense	probably null
R9385:Slc22a23	UTSW	13	34344578	missense	probably benign	0.05
R9630:Slc22a23	UTSW	13	34195407	missense	possibly damaging	0.93
X0064:Slc22a23	UTSW	13	34344466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGGCCTCTTTCTTAGACAC -3'
(R):5'- GCTGACAGTATGCTTTTCACC -3'

Sequencing Primer
(F):5'- CTTTCTTAGACACAGGCTGAGAC -3'
(R):5'- GTCTGATGTGAATACACTTCCATGC -3'

Posted On

2022-08-09