Mutagenetix > Incidental Mutation

Incidental Mutation 'R9561:Raph1'

720985

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R9561 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60525728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 200 (E200G)

Ref Sequence

ENSEMBL: ENSMUSP00000120638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485] [ENSMUST00000142258]

AlphaFold

F2Z3U3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027168
AA Change: E200G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: E200G

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090293
AA Change: E200G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: E200G

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: E200G

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: E200G

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142258
AA Change: E200G

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000120638
Gene: ENSMUSG00000026014
AA Change: E200G

Domain	Start	End	E-Value	Type
low complexity region	202	212	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	A	G	16: 4,863,116	I106V	possibly damaging	Het
Aars	C	A	8: 111,036,983	F18L	probably damaging	Het
Abca7	C	T	10: 80,001,701	T473I	probably damaging	Het
Ap1m2	A	T	9: 21,298,228	I384N	probably damaging	Het
Atg16l2	G	A	7: 101,299,041	Q99*	probably null	Het
Bptf	A	T	11: 107,074,128	Y1413*	probably null	Het
Cat	T	C	2: 103,476,905	T28A	probably damaging	Het
Ccdc65	T	A	15: 98,722,878	V418D	probably benign	Het
Cd226	A	C	18: 89,247,320	I241L	probably benign	Het
Crybg1	A	G	10: 43,997,432	S1227P	probably benign	Het
Csn2	C	T	5: 87,694,935	A78T	probably benign	Het
Cyp21a1	T	A	17: 34,802,678	H305L	possibly damaging	Het
Ddx55	A	G	5: 124,568,644	E572G	possibly damaging	Het
Dguok	A	G	6: 83,490,566	Y100H	probably damaging	Het
Dync1h1	T	A	12: 110,649,099	S2955R	probably damaging	Het
Etfbkmt	A	T	6: 149,144,142		probably benign	Het
Fam222a	T	A	5: 114,611,286	I181N	probably damaging	Het
Fam24b	T	C	7: 131,326,148	D104G	probably benign	Het
Fbn2	A	T	18: 58,048,539	C1883*	probably null	Het
Fchsd2	T	G	7: 101,271,571	L461R	probably benign	Het
Hdgfl1	C	T	13: 26,769,256	G278E	probably damaging	Het
Hectd4	G	A	5: 121,334,469	R2756Q	possibly damaging	Het
Ints14	A	G	9: 64,975,650	D261G	probably damaging	Het
Mapkapk5	C	T	5: 121,534,427	A163T	probably benign	Het
Micu3	A	T	8: 40,382,115	K504*	probably null	Het
Myh1	C	G	11: 67,217,792	H1345D	possibly damaging	Het
Myh7	C	A	14: 54,978,689	R1289L	probably damaging	Het
Neb	G	T	2: 52,242,056	H280Q		Het
Nrbp1	T	A	5: 31,247,427		probably null	Het
Oacyl	T	A	18: 65,698,343	V17D	possibly damaging	Het
Obsl1	C	A	1: 75,503,513	R463L	possibly damaging	Het
Olfr161	T	A	16: 3,592,861	L155Q	probably damaging	Het
Olfr889	G	A	9: 38,116,714	S311N	probably benign	Het
Pcnt	A	T	10: 76,381,294	C2184*	probably null	Het
Pfpl	G	C	19: 12,428,933	E183Q	probably damaging	Het
Phrf1	T	G	7: 141,254,902	S198A	unknown	Het
Plekhg2	C	G	7: 28,364,824	A431P	probably damaging	Het
Ppp1r13b	C	T	12: 111,843,643	D244N	probably damaging	Het
Rnf6	A	G	5: 146,211,126	S361P	probably benign	Het
Scgb2b19	G	A	7: 33,278,614	A86V	probably benign	Het
Sec23b	T	A	2: 144,566,808	C138S	possibly damaging	Het
Slco1c1	T	C	6: 141,559,880	S511P	possibly damaging	Het
Tas2r130	A	G	6: 131,630,212	S207P	probably damaging	Het
Tdpoz1	A	T	3: 93,671,233	H81Q	probably benign	Het
Usp8	A	G	2: 126,736,494	K289E	probably damaging	Het
Vmn1r18	A	C	6: 57,390,217	N117K	probably benign	Het
Vps13c	G	T	9: 67,965,512	G3270V	probably damaging	Het
Wdr20	A	G	12: 110,793,753	T358A	probably benign	Het
Wwc1	A	C	11: 35,979,969		probably null	Het
Yars2	G	T	16: 16,309,378	V436L	possibly damaging	Het
Zfp609	G	A	9: 65,697,230	Q1324*	probably null	Het
Zfp81	T	C	17: 33,334,800	T347A	probably benign	Het
Zgpat	T	C	2: 181,379,573	V292A	probably benign	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGCCATTTCTCTGCATTTTAAGG -3'
(R):5'- AAACATGGCACCCTGAGAGG -3'

Sequencing Primer
(F):5'- CTGCATTTTAAGGCCAAAATAACAG -3'
(R):5'- AGAGGACCGTCATCTTCCTCTAATAG -3'

Posted On

2022-08-09