Incidental Mutation 'R9562:Acacb'
ID 721068
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9562 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 114371397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 1842 (P1842Q)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably damaging
Transcript: ENSMUST00000031583
AA Change: P1842Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: P1842Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102582
AA Change: P1842Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: P1842Q

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,773,635 (GRCm39) R58Q probably null Het
Acvr1 T C 2: 58,338,385 (GRCm39) K446E probably damaging Het
Adam39 T C 8: 41,277,755 (GRCm39) Y49H probably benign Het
Afg3l2 C T 18: 67,554,365 (GRCm39) V446M probably damaging Het
Aire A G 10: 77,871,579 (GRCm39) V397A probably benign Het
Ankdd1a C T 9: 65,411,452 (GRCm39) A352T possibly damaging Het
Aoc1l2 T C 6: 48,907,909 (GRCm39) M303T probably benign Het
Arfip2 T C 7: 105,286,079 (GRCm39) D270G possibly damaging Het
Arl4c A G 1: 88,629,134 (GRCm39) C85R probably damaging Het
Arpp21 A C 9: 111,956,354 (GRCm39) V541G possibly damaging Het
Atp2a3 T A 11: 72,873,578 (GRCm39) M817K probably damaging Het
Bahcc1 C T 11: 120,150,035 (GRCm39) H106Y possibly damaging Het
Bcl9l A G 9: 44,412,076 (GRCm39) S21G possibly damaging Het
C7 T A 15: 5,086,579 (GRCm39) probably null Het
Cabcoco1 T C 10: 68,272,725 (GRCm39) D220G possibly damaging Het
Cacna1e T A 1: 154,283,486 (GRCm39) D1960V probably benign Het
Casp4 A T 9: 5,324,832 (GRCm39) T215S probably damaging Het
Ccdc187 T C 2: 26,183,698 (GRCm39) S101G possibly damaging Het
Cdk12 A G 11: 98,140,628 (GRCm39) N1290D unknown Het
Cdo1 C A 18: 46,861,104 (GRCm39) V36L probably benign Het
Col5a3 G A 9: 20,714,429 (GRCm39) A381V unknown Het
Cspg4b T C 13: 113,504,574 (GRCm39) I1901T Het
Dcpp2 A G 17: 24,119,453 (GRCm39) E89G probably damaging Het
Dhx57 G T 17: 80,561,817 (GRCm39) A899E probably damaging Het
Dnaaf1 T C 8: 120,309,392 (GRCm39) I160T probably damaging Het
Dnah1 C A 14: 30,986,394 (GRCm39) A3698S probably damaging Het
Dnah12 C A 14: 26,597,281 (GRCm39) R3547S possibly damaging Het
Dnah3 A G 7: 119,610,114 (GRCm39) V1774A probably benign Het
Dop1a G A 9: 86,424,811 (GRCm39) R2085Q probably damaging Het
Duox1 T C 2: 122,151,203 (GRCm39) Y293H probably damaging Het
Efcab5 G A 11: 77,022,934 (GRCm39) T593I probably damaging Het
Elp1 G T 4: 56,772,521 (GRCm39) P867T probably benign Het
Epas1 T A 17: 87,112,667 (GRCm39) D88E probably damaging Het
Epdr1 A G 13: 19,778,821 (GRCm39) F92L possibly damaging Het
Ercc6 T C 14: 32,296,924 (GRCm39) W1305R probably damaging Het
Etv6 A G 6: 134,225,672 (GRCm39) N212S probably benign Het
Fam20b A T 1: 156,530,010 (GRCm39) Y141* probably null Het
Fancm A G 12: 65,168,494 (GRCm39) N1619S probably damaging Het
Fbln5 A T 12: 101,734,722 (GRCm39) N183K probably damaging Het
Fer1l6 A G 15: 58,490,370 (GRCm39) D976G possibly damaging Het
Fgb T C 3: 82,952,409 (GRCm39) probably null Het
Fhod1 A T 8: 106,074,422 (GRCm39) Y22N unknown Het
Foxl3 C A 5: 138,807,213 (GRCm39) Q164K probably benign Het
Galm C T 17: 80,490,859 (GRCm39) Q166* probably null Het
Gbe1 A T 16: 70,198,664 (GRCm39) Y119F probably benign Het
Gcnt7 T A 2: 172,293,180 (GRCm39) Y369F probably damaging Het
Gdap2 T C 3: 100,099,006 (GRCm39) I366T possibly damaging Het
Gm14295 T C 2: 176,499,162 (GRCm39) V4A probably benign Het
Gm32742 T A 9: 51,068,327 (GRCm39) Y249F probably benign Het
Gm40460 A T 7: 141,794,701 (GRCm39) C39S unknown Het
Gm6370 T A 5: 146,429,281 (GRCm39) C120* probably null Het
Harbi1 T A 2: 91,542,698 (GRCm39) L53* probably null Het
Herc3 A G 6: 58,835,999 (GRCm39) N280S probably null Het
Hipk2 T A 6: 38,724,390 (GRCm39) R447W probably damaging Het
Hydin A G 8: 111,312,786 (GRCm39) I4176V probably benign Het
Ifi211 A T 1: 173,733,052 (GRCm39) I203N probably benign Het
Kcnc1 G A 7: 46,077,010 (GRCm39) V271M probably benign Het
Kcng1 T A 2: 168,104,797 (GRCm39) I350F probably damaging Het
Kif21b A T 1: 136,077,090 (GRCm39) I371F probably damaging Het
Klrc1 A G 6: 129,655,746 (GRCm39) F43S probably damaging Het
Krtap6-2 A G 16: 89,216,722 (GRCm39) S82P unknown Het
Lamb1 T A 12: 31,322,492 (GRCm39) M186K probably damaging Het
Lrig2 T C 3: 104,375,924 (GRCm39) K451E possibly damaging Het
Lrrc15 G A 16: 30,093,016 (GRCm39) L108F probably damaging Het
Mark3 A G 12: 111,570,960 (GRCm39) I87V probably damaging Het
Mlh1 T C 9: 111,060,013 (GRCm39) K622E Het
Mrgprb2 G A 7: 48,202,674 (GRCm39) T17M possibly damaging Het
Msantd5f4 G T 4: 73,557,190 (GRCm39) V8F probably damaging Het
Mtmr4 C T 11: 87,493,241 (GRCm39) R225C probably damaging Het
Nfatc1 A G 18: 80,678,916 (GRCm39) L824P probably damaging Het
Nlrp4f A T 13: 65,347,053 (GRCm39) D46E probably damaging Het
Oga CTCGGGTC CTC 19: 45,743,096 (GRCm39) probably null Het
Or10h5 G T 17: 33,434,415 (GRCm39) T301N probably benign Het
Or13n4 A C 7: 106,423,020 (GRCm39) F238V probably damaging Het
Or1l4 G T 2: 37,091,575 (GRCm39) M107I probably benign Het
Or2w25 T A 11: 59,504,580 (GRCm39) N263K probably damaging Het
Or6z7 G C 7: 6,483,243 (GRCm39) A304G probably null Het
Or7e173 T A 9: 19,939,045 (GRCm39) Y63F probably damaging Het
Or8b1 G T 9: 38,400,092 (GRCm39) A256S possibly damaging Het
Otulin A G 15: 27,608,812 (GRCm39) Y244H probably damaging Het
Pabpc4 T C 4: 123,180,653 (GRCm39) I125T probably damaging Het
Parp14 A G 16: 35,677,775 (GRCm39) I731T probably benign Het
Parp8 T C 13: 117,029,631 (GRCm39) T531A probably benign Het
Parvg G T 15: 84,213,065 (GRCm39) V49L probably benign Het
Pcdha12 T C 18: 37,155,284 (GRCm39) S668P probably damaging Het
Pcdhb9 A C 18: 37,534,665 (GRCm39) N220H probably benign Het
Pcdhga4 T G 18: 37,819,527 (GRCm39) S359A probably benign Het
Pi4k2b T A 5: 52,908,799 (GRCm39) S208R probably damaging Het
Plxnb2 T C 15: 89,050,136 (GRCm39) Y487C probably damaging Het
Pm20d1 G A 1: 131,730,501 (GRCm39) V252I probably damaging Het
Pxdc1 T A 13: 34,836,258 (GRCm39) H54L probably damaging Het
Rag1 A T 2: 101,473,327 (GRCm39) V605E probably damaging Het
Rasgrf2 A T 13: 92,034,469 (GRCm39) probably null Het
Relch T C 1: 105,591,876 (GRCm39) V15A probably damaging Het
Rflnb T A 11: 75,912,951 (GRCm39) T146S probably damaging Het
Rfx5 T A 3: 94,866,639 (GRCm39) L646Q unknown Het
Rnf43 A G 11: 87,618,891 (GRCm39) T81A probably benign Het
Ros1 T C 10: 51,943,170 (GRCm39) D2048G probably damaging Het
Rpl13a-ps1 T A 19: 50,018,612 (GRCm39) K188I possibly damaging Het
Rpl24 T A 16: 55,790,509 (GRCm39) S122T probably benign Het
Ryr2 G A 13: 11,760,104 (GRCm39) T1549M probably damaging Het
Sbf2 T C 7: 110,040,702 (GRCm39) Q375R possibly damaging Het
Sec23a A T 12: 59,048,817 (GRCm39) F131I possibly damaging Het
Secisbp2 T C 13: 51,837,320 (GRCm39) I827T probably damaging Het
Serpinb6d A G 13: 33,854,756 (GRCm39) R244G probably benign Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Snx17 C A 5: 31,355,088 (GRCm39) Q368K probably damaging Het
Stac T A 9: 111,401,411 (GRCm39) E345V probably benign Het
Stx4a A G 7: 127,445,375 (GRCm39) N164S possibly damaging Het
Tasor T C 14: 27,201,766 (GRCm39) probably null Het
Tbcb A T 7: 29,930,549 (GRCm39) probably null Het
Tecpr2 T C 12: 110,914,141 (GRCm39) S1151P possibly damaging Het
Timm50 A G 7: 28,007,069 (GRCm39) F202S possibly damaging Het
Tle2 A G 10: 81,417,567 (GRCm39) D244G probably benign Het
Tlr4 G A 4: 66,759,522 (GRCm39) V772I possibly damaging Het
Tmem214 G A 5: 31,027,043 (GRCm39) W11* probably null Het
Tmem241 A T 18: 12,176,356 (GRCm39) L227* probably null Het
Top2b A C 14: 16,365,718 (GRCm38) T14P probably benign Het
Trim44 T C 2: 102,187,827 (GRCm39) T309A probably benign Het
Trps1 A C 15: 50,524,657 (GRCm39) I1091S probably damaging Het
Tspan2 C A 3: 102,672,583 (GRCm39) T200K probably damaging Het
Tuba8 A G 6: 121,200,063 (GRCm39) N249S probably benign Het
Vmn1r189 A G 13: 22,286,426 (GRCm39) L137P probably damaging Het
Vmn2r29 A T 7: 7,244,855 (GRCm39) W340R probably benign Het
Vmn2r52 A C 7: 9,893,476 (GRCm39) D554E probably benign Het
Zc3h4 C G 7: 16,168,891 (GRCm39) P1075R unknown Het
Zfp599 A G 9: 22,160,999 (GRCm39) S389P probably damaging Het
Zfp777 A T 6: 48,021,580 (GRCm39) V14D possibly damaging Het
Zswim8 C T 14: 20,762,150 (GRCm39) Q262* probably null Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATCGGCAATGACATCACCTTC -3'
(R):5'- AGATACCTCACGTACAGCATCTTC -3'

Sequencing Primer
(F):5'- CCAAATCGGCTCTTTCGGCATAG -3'
(R):5'- CAGGTACTTGCGTTCTGACTGAAAC -3'
Posted On 2022-08-09