Incidental Mutation 'R9562:1600015I10Rik'
ID 721073
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene Name RIKEN cDNA 1600015I10 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9562 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 48929895-48933687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48930975 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 303 (M303T)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
AlphaFold E9Q745
Predicted Effect probably benign
Transcript: ENSMUST00000031837
AA Change: M303T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: M303T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,664,151 V15A probably damaging Het
Acacb C A 5: 114,233,336 P1842Q probably damaging Het
Aco2 G A 15: 81,889,434 R58Q probably null Het
Acvr1 T C 2: 58,448,373 K446E probably damaging Het
Adam39 T C 8: 40,824,718 Y49H probably benign Het
Afg3l2 C T 18: 67,421,295 V446M probably damaging Het
Aire A G 10: 78,035,745 V397A probably benign Het
Ankdd1a C T 9: 65,504,170 A352T possibly damaging Het
Arfip2 T C 7: 105,636,872 D270G possibly damaging Het
Arl4c A G 1: 88,701,412 C85R probably damaging Het
Arpp21 A C 9: 112,127,286 V541G possibly damaging Het
Atp2a3 T A 11: 72,982,752 M817K probably damaging Het
Bahcc1 C T 11: 120,259,209 H106Y possibly damaging Het
BC067074 T C 13: 113,368,040 I1901T Het
Bcl9l A G 9: 44,500,779 S21G possibly damaging Het
C7 T A 15: 5,057,097 probably null Het
Cabcoco1 T C 10: 68,436,895 D220G possibly damaging Het
Cacna1e T A 1: 154,407,740 D1960V probably benign Het
Casp4 A T 9: 5,324,832 T215S probably damaging Het
Ccdc187 T C 2: 26,293,686 S101G possibly damaging Het
Cdk12 A G 11: 98,249,802 N1290D unknown Het
Cdo1 C A 18: 46,728,037 V36L probably benign Het
Col5a3 G A 9: 20,803,133 A381V unknown Het
Dcpp2 A G 17: 23,900,479 E89G probably damaging Het
Dhx57 G T 17: 80,254,388 A899E probably damaging Het
Dnaaf1 T C 8: 119,582,653 I160T probably damaging Het
Dnah1 C A 14: 31,264,437 A3698S probably damaging Het
Dnah12 C A 14: 26,875,324 R3547S possibly damaging Het
Dnah3 A G 7: 120,010,891 V1774A probably benign Het
Dopey1 G A 9: 86,542,758 R2085Q probably damaging Het
Duox1 T C 2: 122,320,722 Y293H probably damaging Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Epas1 T A 17: 86,805,239 D88E probably damaging Het
Epdr1 A G 13: 19,594,651 F92L possibly damaging Het
Ercc6 T C 14: 32,574,967 W1305R probably damaging Het
Etv6 A G 6: 134,248,709 N212S probably benign Het
Fam208a T C 14: 27,479,809 probably null Het
Fam20b A T 1: 156,702,440 Y141* probably null Het
Fancm A G 12: 65,121,720 N1619S probably damaging Het
Fbln5 A T 12: 101,768,463 N183K probably damaging Het
Fer1l6 A G 15: 58,618,521 D976G possibly damaging Het
Fgb T C 3: 83,045,102 probably null Het
Fhod1 A T 8: 105,347,790 Y22N unknown Het
Galm C T 17: 80,183,430 Q166* probably null Het
Gbe1 A T 16: 70,401,776 Y119F probably benign Het
Gcnt7 T A 2: 172,451,260 Y369F probably damaging Het
Gdap2 T C 3: 100,191,690 I366T possibly damaging Het
Gm11236 G T 4: 73,638,953 V8F probably damaging Het
Gm14295 T C 2: 176,807,369 V4A probably benign Het
Gm32742 T A 9: 51,157,027 Y249F probably benign Het
Gm40460 A T 7: 142,240,964 C39S unknown Het
Gm5294 C A 5: 138,821,458 Q164K probably benign Het
Gm6370 T A 5: 146,492,471 C120* probably null Het
Harbi1 T A 2: 91,712,353 L53* probably null Het
Herc3 A G 6: 58,859,014 N280S probably null Het
Hipk2 T A 6: 38,747,455 R447W probably damaging Het
Hydin A G 8: 110,586,154 I4176V probably benign Het
Ifi211 A T 1: 173,905,486 I203N probably benign Het
Ikbkap G T 4: 56,772,521 P867T probably benign Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Kcng1 T A 2: 168,262,877 I350F probably damaging Het
Kif21b A T 1: 136,149,352 I371F probably damaging Het
Klrc1 A G 6: 129,678,783 F43S probably damaging Het
Krtap6-2 A G 16: 89,419,834 S82P unknown Het
Lamb1 T A 12: 31,272,493 M186K probably damaging Het
Lrig2 T C 3: 104,468,608 K451E possibly damaging Het
Lrrc15 G A 16: 30,274,198 L108F probably damaging Het
Mark3 A G 12: 111,604,526 I87V probably damaging Het
Mgea5 CTCGGGTC CTC 19: 45,754,657 probably null Het
Mlh1 T C 9: 111,230,945 K622E Het
Mrgprb2 G A 7: 48,552,926 T17M possibly damaging Het
Mtmr4 C T 11: 87,602,415 R225C probably damaging Het
Nfatc1 A G 18: 80,635,701 L824P probably damaging Het
Nlrp4f A T 13: 65,199,239 D46E probably damaging Het
Olfr1564 G T 17: 33,215,441 T301N probably benign Het
Olfr225 T A 11: 59,613,754 N263K probably damaging Het
Olfr365 G T 2: 37,201,563 M107I probably benign Het
Olfr5 G C 7: 6,480,244 A304G probably null Het
Olfr702 A C 7: 106,823,813 F238V probably damaging Het
Olfr866 T A 9: 20,027,749 Y63F probably damaging Het
Olfr906 G T 9: 38,488,796 A256S possibly damaging Het
Otulin A G 15: 27,608,726 Y244H probably damaging Het
Pabpc4 T C 4: 123,286,860 I125T probably damaging Het
Parp14 A G 16: 35,857,405 I731T probably benign Het
Parp8 T C 13: 116,893,095 T531A probably benign Het
Parvg G T 15: 84,328,864 V49L probably benign Het
Pcdha12 T C 18: 37,022,231 S668P probably damaging Het
Pcdhb9 A C 18: 37,401,612 N220H probably benign Het
Pcdhga4 T G 18: 37,686,474 S359A probably benign Het
Pi4k2b T A 5: 52,751,457 S208R probably damaging Het
Plxnb2 T C 15: 89,165,933 Y487C probably damaging Het
Pm20d1 G A 1: 131,802,763 V252I probably damaging Het
Pxdc1 T A 13: 34,652,275 H54L probably damaging Het
Rag1 A T 2: 101,642,982 V605E probably damaging Het
Rasgrf2 A T 13: 91,886,350 probably null Het
Rflnb T A 11: 76,022,125 T146S probably damaging Het
Rfx5 T A 3: 94,959,328 L646Q unknown Het
Rnf43 A G 11: 87,728,065 T81A probably benign Het
Ros1 T C 10: 52,067,074 D2048G probably damaging Het
Rpl13a-ps1 T A 19: 50,030,173 K188I possibly damaging Het
Rpl24 T A 16: 55,970,146 S122T probably benign Het
Ryr2 G A 13: 11,745,218 T1549M probably damaging Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sec23a A T 12: 59,002,031 F131I possibly damaging Het
Secisbp2 T C 13: 51,683,284 I827T probably damaging Het
Serpinb6d A G 13: 33,670,773 R244G probably benign Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Snx17 C A 5: 31,197,744 Q368K probably damaging Het
Stac T A 9: 111,572,343 E345V probably benign Het
Stx4a A G 7: 127,846,203 N164S possibly damaging Het
Tbcb A T 7: 30,231,124 probably null Het
Tecpr2 T C 12: 110,947,707 S1151P possibly damaging Het
Timm50 A G 7: 28,307,644 F202S possibly damaging Het
Tle2 A G 10: 81,581,733 D244G probably benign Het
Tlr4 G A 4: 66,841,285 V772I possibly damaging Het
Tmem214 G A 5: 30,869,699 W11* probably null Het
Tmem241 A T 18: 12,043,299 L227* probably null Het
Top2b A C 14: 16,365,718 T14P probably benign Het
Trim44 T C 2: 102,357,482 T309A probably benign Het
Trps1 A C 15: 50,661,261 I1091S probably damaging Het
Tspan2 C A 3: 102,765,267 T200K probably damaging Het
Tuba8 A G 6: 121,223,104 N249S probably benign Het
Vmn1r189 A G 13: 22,102,256 L137P probably damaging Het
Vmn2r29 A T 7: 7,241,856 W340R probably benign Het
Vmn2r52 A C 7: 10,159,549 D554E probably benign Het
Zc3h4 C G 7: 16,434,966 P1075R unknown Het
Zfp599 A G 9: 22,249,703 S389P probably damaging Het
Zfp777 A T 6: 48,044,646 V14D possibly damaging Het
Zswim8 C T 14: 20,712,082 Q262* probably null Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8391:1600015I10Rik UTSW 6 48932668 missense probably damaging 0.96
R8839:1600015I10Rik UTSW 6 48931040 missense probably damaging 1.00
R8863:1600015I10Rik UTSW 6 48930108 missense probably benign 0.00
R9266:1600015I10Rik UTSW 6 48930237 missense probably benign 0.00
R9274:1600015I10Rik UTSW 6 48930407 missense possibly damaging 0.94
R9380:1600015I10Rik UTSW 6 48933130 missense probably damaging 1.00
R9382:1600015I10Rik UTSW 6 48930364 missense probably benign 0.08
R9565:1600015I10Rik UTSW 6 48930975 missense probably benign 0.01
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CTGGAAAGTGAAGCAGCTCTG -3'
(R):5'- CTGAGTGCCTGCAGATACATG -3'

Sequencing Primer
(F):5'- TCTGGTATAACGGCAAGCTC -3'
(R):5'- AGATACATGTCCTCCGAACTGTG -3'
Posted On 2022-08-09