Incidental Mutation 'R9562:Dhx57'
ID 721157
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R9562 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80561817 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 899 (A899E)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect probably benign
Transcript: ENSMUST00000038166
AA Change: A846E

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: A846E

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: A899E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: A899E

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb C A 5: 114,371,397 (GRCm39) P1842Q probably damaging Het
Aco2 G A 15: 81,773,635 (GRCm39) R58Q probably null Het
Acvr1 T C 2: 58,338,385 (GRCm39) K446E probably damaging Het
Adam39 T C 8: 41,277,755 (GRCm39) Y49H probably benign Het
Afg3l2 C T 18: 67,554,365 (GRCm39) V446M probably damaging Het
Aire A G 10: 77,871,579 (GRCm39) V397A probably benign Het
Ankdd1a C T 9: 65,411,452 (GRCm39) A352T possibly damaging Het
Aoc1l2 T C 6: 48,907,909 (GRCm39) M303T probably benign Het
Arfip2 T C 7: 105,286,079 (GRCm39) D270G possibly damaging Het
Arl4c A G 1: 88,629,134 (GRCm39) C85R probably damaging Het
Arpp21 A C 9: 111,956,354 (GRCm39) V541G possibly damaging Het
Atp2a3 T A 11: 72,873,578 (GRCm39) M817K probably damaging Het
Bahcc1 C T 11: 120,150,035 (GRCm39) H106Y possibly damaging Het
Bcl9l A G 9: 44,412,076 (GRCm39) S21G possibly damaging Het
C7 T A 15: 5,086,579 (GRCm39) probably null Het
Cabcoco1 T C 10: 68,272,725 (GRCm39) D220G possibly damaging Het
Cacna1e T A 1: 154,283,486 (GRCm39) D1960V probably benign Het
Casp4 A T 9: 5,324,832 (GRCm39) T215S probably damaging Het
Ccdc187 T C 2: 26,183,698 (GRCm39) S101G possibly damaging Het
Cdk12 A G 11: 98,140,628 (GRCm39) N1290D unknown Het
Cdo1 C A 18: 46,861,104 (GRCm39) V36L probably benign Het
Col5a3 G A 9: 20,714,429 (GRCm39) A381V unknown Het
Cspg4b T C 13: 113,504,574 (GRCm39) I1901T Het
Dcpp2 A G 17: 24,119,453 (GRCm39) E89G probably damaging Het
Dnaaf1 T C 8: 120,309,392 (GRCm39) I160T probably damaging Het
Dnah1 C A 14: 30,986,394 (GRCm39) A3698S probably damaging Het
Dnah12 C A 14: 26,597,281 (GRCm39) R3547S possibly damaging Het
Dnah3 A G 7: 119,610,114 (GRCm39) V1774A probably benign Het
Dop1a G A 9: 86,424,811 (GRCm39) R2085Q probably damaging Het
Duox1 T C 2: 122,151,203 (GRCm39) Y293H probably damaging Het
Efcab5 G A 11: 77,022,934 (GRCm39) T593I probably damaging Het
Elp1 G T 4: 56,772,521 (GRCm39) P867T probably benign Het
Epas1 T A 17: 87,112,667 (GRCm39) D88E probably damaging Het
Epdr1 A G 13: 19,778,821 (GRCm39) F92L possibly damaging Het
Ercc6 T C 14: 32,296,924 (GRCm39) W1305R probably damaging Het
Etv6 A G 6: 134,225,672 (GRCm39) N212S probably benign Het
Fam20b A T 1: 156,530,010 (GRCm39) Y141* probably null Het
Fancm A G 12: 65,168,494 (GRCm39) N1619S probably damaging Het
Fbln5 A T 12: 101,734,722 (GRCm39) N183K probably damaging Het
Fer1l6 A G 15: 58,490,370 (GRCm39) D976G possibly damaging Het
Fgb T C 3: 82,952,409 (GRCm39) probably null Het
Fhod1 A T 8: 106,074,422 (GRCm39) Y22N unknown Het
Foxl3 C A 5: 138,807,213 (GRCm39) Q164K probably benign Het
Galm C T 17: 80,490,859 (GRCm39) Q166* probably null Het
Gbe1 A T 16: 70,198,664 (GRCm39) Y119F probably benign Het
Gcnt7 T A 2: 172,293,180 (GRCm39) Y369F probably damaging Het
Gdap2 T C 3: 100,099,006 (GRCm39) I366T possibly damaging Het
Gm14295 T C 2: 176,499,162 (GRCm39) V4A probably benign Het
Gm32742 T A 9: 51,068,327 (GRCm39) Y249F probably benign Het
Gm40460 A T 7: 141,794,701 (GRCm39) C39S unknown Het
Gm6370 T A 5: 146,429,281 (GRCm39) C120* probably null Het
Harbi1 T A 2: 91,542,698 (GRCm39) L53* probably null Het
Herc3 A G 6: 58,835,999 (GRCm39) N280S probably null Het
Hipk2 T A 6: 38,724,390 (GRCm39) R447W probably damaging Het
Hydin A G 8: 111,312,786 (GRCm39) I4176V probably benign Het
Ifi211 A T 1: 173,733,052 (GRCm39) I203N probably benign Het
Kcnc1 G A 7: 46,077,010 (GRCm39) V271M probably benign Het
Kcng1 T A 2: 168,104,797 (GRCm39) I350F probably damaging Het
Kif21b A T 1: 136,077,090 (GRCm39) I371F probably damaging Het
Klrc1 A G 6: 129,655,746 (GRCm39) F43S probably damaging Het
Krtap6-2 A G 16: 89,216,722 (GRCm39) S82P unknown Het
Lamb1 T A 12: 31,322,492 (GRCm39) M186K probably damaging Het
Lrig2 T C 3: 104,375,924 (GRCm39) K451E possibly damaging Het
Lrrc15 G A 16: 30,093,016 (GRCm39) L108F probably damaging Het
Mark3 A G 12: 111,570,960 (GRCm39) I87V probably damaging Het
Mlh1 T C 9: 111,060,013 (GRCm39) K622E Het
Mrgprb2 G A 7: 48,202,674 (GRCm39) T17M possibly damaging Het
Msantd5f4 G T 4: 73,557,190 (GRCm39) V8F probably damaging Het
Mtmr4 C T 11: 87,493,241 (GRCm39) R225C probably damaging Het
Nfatc1 A G 18: 80,678,916 (GRCm39) L824P probably damaging Het
Nlrp4f A T 13: 65,347,053 (GRCm39) D46E probably damaging Het
Oga CTCGGGTC CTC 19: 45,743,096 (GRCm39) probably null Het
Or10h5 G T 17: 33,434,415 (GRCm39) T301N probably benign Het
Or13n4 A C 7: 106,423,020 (GRCm39) F238V probably damaging Het
Or1l4 G T 2: 37,091,575 (GRCm39) M107I probably benign Het
Or2w25 T A 11: 59,504,580 (GRCm39) N263K probably damaging Het
Or6z7 G C 7: 6,483,243 (GRCm39) A304G probably null Het
Or7e173 T A 9: 19,939,045 (GRCm39) Y63F probably damaging Het
Or8b1 G T 9: 38,400,092 (GRCm39) A256S possibly damaging Het
Otulin A G 15: 27,608,812 (GRCm39) Y244H probably damaging Het
Pabpc4 T C 4: 123,180,653 (GRCm39) I125T probably damaging Het
Parp14 A G 16: 35,677,775 (GRCm39) I731T probably benign Het
Parp8 T C 13: 117,029,631 (GRCm39) T531A probably benign Het
Parvg G T 15: 84,213,065 (GRCm39) V49L probably benign Het
Pcdha12 T C 18: 37,155,284 (GRCm39) S668P probably damaging Het
Pcdhb9 A C 18: 37,534,665 (GRCm39) N220H probably benign Het
Pcdhga4 T G 18: 37,819,527 (GRCm39) S359A probably benign Het
Pi4k2b T A 5: 52,908,799 (GRCm39) S208R probably damaging Het
Plxnb2 T C 15: 89,050,136 (GRCm39) Y487C probably damaging Het
Pm20d1 G A 1: 131,730,501 (GRCm39) V252I probably damaging Het
Pxdc1 T A 13: 34,836,258 (GRCm39) H54L probably damaging Het
Rag1 A T 2: 101,473,327 (GRCm39) V605E probably damaging Het
Rasgrf2 A T 13: 92,034,469 (GRCm39) probably null Het
Relch T C 1: 105,591,876 (GRCm39) V15A probably damaging Het
Rflnb T A 11: 75,912,951 (GRCm39) T146S probably damaging Het
Rfx5 T A 3: 94,866,639 (GRCm39) L646Q unknown Het
Rnf43 A G 11: 87,618,891 (GRCm39) T81A probably benign Het
Ros1 T C 10: 51,943,170 (GRCm39) D2048G probably damaging Het
Rpl13a-ps1 T A 19: 50,018,612 (GRCm39) K188I possibly damaging Het
Rpl24 T A 16: 55,790,509 (GRCm39) S122T probably benign Het
Ryr2 G A 13: 11,760,104 (GRCm39) T1549M probably damaging Het
Sbf2 T C 7: 110,040,702 (GRCm39) Q375R possibly damaging Het
Sec23a A T 12: 59,048,817 (GRCm39) F131I possibly damaging Het
Secisbp2 T C 13: 51,837,320 (GRCm39) I827T probably damaging Het
Serpinb6d A G 13: 33,854,756 (GRCm39) R244G probably benign Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Snx17 C A 5: 31,355,088 (GRCm39) Q368K probably damaging Het
Stac T A 9: 111,401,411 (GRCm39) E345V probably benign Het
Stx4a A G 7: 127,445,375 (GRCm39) N164S possibly damaging Het
Tasor T C 14: 27,201,766 (GRCm39) probably null Het
Tbcb A T 7: 29,930,549 (GRCm39) probably null Het
Tecpr2 T C 12: 110,914,141 (GRCm39) S1151P possibly damaging Het
Timm50 A G 7: 28,007,069 (GRCm39) F202S possibly damaging Het
Tle2 A G 10: 81,417,567 (GRCm39) D244G probably benign Het
Tlr4 G A 4: 66,759,522 (GRCm39) V772I possibly damaging Het
Tmem214 G A 5: 31,027,043 (GRCm39) W11* probably null Het
Tmem241 A T 18: 12,176,356 (GRCm39) L227* probably null Het
Top2b A C 14: 16,365,718 (GRCm38) T14P probably benign Het
Trim44 T C 2: 102,187,827 (GRCm39) T309A probably benign Het
Trps1 A C 15: 50,524,657 (GRCm39) I1091S probably damaging Het
Tspan2 C A 3: 102,672,583 (GRCm39) T200K probably damaging Het
Tuba8 A G 6: 121,200,063 (GRCm39) N249S probably benign Het
Vmn1r189 A G 13: 22,286,426 (GRCm39) L137P probably damaging Het
Vmn2r29 A T 7: 7,244,855 (GRCm39) W340R probably benign Het
Vmn2r52 A C 7: 9,893,476 (GRCm39) D554E probably benign Het
Zc3h4 C G 7: 16,168,891 (GRCm39) P1075R unknown Het
Zfp599 A G 9: 22,160,999 (GRCm39) S389P probably damaging Het
Zfp777 A T 6: 48,021,580 (GRCm39) V14D possibly damaging Het
Zswim8 C T 14: 20,762,150 (GRCm39) Q262* probably null Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTAACCATTAAGAGCCGTGTTATCC -3'
(R):5'- GCTGTGCTCAAAGCTGACAG -3'

Sequencing Primer
(F):5'- GCCGTGTTATCCTAAAAGAGGTTAG -3'
(R):5'- ACCATGGCAGCTCTTATGAG -3'
Posted On 2022-08-09