Incidental Mutation 'R9563:Itga8'
ID 721177
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R9563 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12165219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 797 (I797F)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect possibly damaging
Transcript: ENSMUST00000028106
AA Change: I797F

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: I797F

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,645,009 (GRCm39) D953E probably damaging Het
Acod1 A C 14: 103,287,109 (GRCm39) Y80S probably damaging Het
Actr5 A G 2: 158,470,135 (GRCm39) D255G probably damaging Het
Akna A G 4: 63,312,944 (GRCm39) V393A probably damaging Het
Amotl1 T C 9: 14,473,513 (GRCm39) K562R possibly damaging Het
Amz1 T A 5: 140,738,133 (GRCm39) D464E probably damaging Het
Anapc1 G A 2: 128,505,980 (GRCm39) Q619* probably null Het
Arfgef3 C T 10: 18,522,275 (GRCm39) G584R probably damaging Het
Armt1 AC A 10: 4,400,848 (GRCm39) probably null Het
Atr G C 9: 95,802,833 (GRCm39) V1832L probably damaging Het
Bsn T C 9: 107,984,616 (GRCm39) D374G Het
Cap1 A G 4: 122,758,505 (GRCm39) V225A probably benign Het
Cc2d1a A G 8: 84,863,758 (GRCm39) S562P probably benign Het
Ccdc30 T C 4: 119,250,821 (GRCm39) N141S possibly damaging Het
Cdc42bpb A G 12: 111,265,762 (GRCm39) V1390A possibly damaging Het
Cdc42ep1 A T 15: 78,733,782 (GRCm39) H294L probably benign Het
Col6a6 C A 9: 105,572,952 (GRCm39) G2185C probably benign Het
Col7a1 T C 9: 108,791,809 (GRCm39) V1232A unknown Het
Copb1 A G 7: 113,836,034 (GRCm39) I449T possibly damaging Het
Cplane1 T G 15: 8,216,563 (GRCm39) L594V probably benign Het
Ctdsp2 A G 10: 126,832,040 (GRCm39) D216G probably damaging Het
Cttnbp2 T A 6: 18,367,382 (GRCm39) K1645N probably benign Het
Cttnbp2 A T 6: 18,427,467 (GRCm39) L738* probably null Het
Cul9 T A 17: 46,820,897 (GRCm39) T1927S probably benign Het
Cyfip2 A G 11: 46,151,707 (GRCm39) C531R probably benign Het
Cyp2j6 A G 4: 96,414,245 (GRCm39) I340T probably damaging Het
Daam1 A G 12: 71,992,251 (GRCm39) E322G unknown Het
Dab2ip T A 2: 35,609,915 (GRCm39) L710* probably null Het
Degs1l G T 1: 180,882,810 (GRCm39) V191F possibly damaging Het
Dph1 T C 11: 75,076,825 (GRCm39) T60A possibly damaging Het
Eme1 T C 11: 94,541,339 (GRCm39) D161G probably benign Het
Epha3 C T 16: 63,366,510 (GRCm39) G980D possibly damaging Het
Eri3 T A 4: 117,422,013 (GRCm39) V136E probably benign Het
Espl1 T A 15: 102,228,233 (GRCm39) I1669N possibly damaging Het
Exoc6 T C 19: 37,588,071 (GRCm39) I568T probably damaging Het
F3 T A 3: 121,527,822 (GRCm39) L85H Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbxw14 T C 9: 109,106,335 (GRCm39) Y234C probably benign Het
Fbxw25 T A 9: 109,483,676 (GRCm39) N179Y Het
Foxr1 T A 9: 44,352,199 (GRCm39) probably benign Het
Gas8 T A 8: 124,263,179 (GRCm39) V452E possibly damaging Het
Gdpd4 T C 7: 97,649,369 (GRCm39) V450A probably damaging Het
Greb1 T C 12: 16,774,824 (GRCm39) Y191C probably benign Het
H3c11 T C 13: 21,967,221 (GRCm39) D107G probably damaging Het
Haus3 G A 5: 34,325,300 (GRCm39) R120W probably benign Het
Herc1 G T 9: 66,294,193 (GRCm39) probably null Het
Hyal2 T C 9: 107,447,844 (GRCm39) W166R probably damaging Het
Inka1 T A 9: 107,861,488 (GRCm39) Y276F probably benign Het
Itga7 C T 10: 128,789,669 (GRCm39) A1003V probably damaging Het
Kank2 T C 9: 21,705,852 (GRCm39) T389A possibly damaging Het
Kcnb2 T A 1: 15,779,737 (GRCm39) I203N probably damaging Het
Kif21b T A 1: 136,077,166 (GRCm39) L396Q probably damaging Het
Kng1 T G 16: 22,879,170 (GRCm39) I78S probably damaging Het
Ldlrad4 T C 18: 68,387,551 (GRCm39) S288P probably benign Het
Lmntd2 A G 7: 140,790,701 (GRCm39) S516P Het
Lrp1b T A 2: 41,185,711 (GRCm39) I1449F Het
Lrrk2 T A 15: 91,634,043 (GRCm39) I1380K possibly damaging Het
Lvrn T G 18: 47,017,506 (GRCm39) I612S probably damaging Het
Lyst T C 13: 13,812,408 (GRCm39) L940P probably benign Het
Man2a2 T A 7: 80,006,101 (GRCm39) M996L probably benign Het
Map3k3 T A 11: 106,041,860 (GRCm39) I413N probably damaging Het
Map4k5 A G 12: 69,863,167 (GRCm39) V629A probably benign Het
Mapre2 A G 18: 24,023,981 (GRCm39) E325G unknown Het
Mbnl1 A G 3: 60,520,715 (GRCm39) N101S probably benign Het
Meltf T A 16: 31,703,869 (GRCm39) C199S probably damaging Het
Mmab T C 5: 114,574,850 (GRCm39) E141G probably benign Het
Mtcl2 G A 2: 156,902,182 (GRCm39) R278C probably damaging Het
Mtus2 T C 5: 148,250,217 (GRCm39) L1317P Het
Muc6 T A 7: 141,217,783 (GRCm39) T2297S possibly damaging Het
Myom2 A T 8: 15,158,399 (GRCm39) K784* probably null Het
Nek1 A G 8: 61,577,157 (GRCm39) E1118G probably benign Het
Nrtn A G 17: 57,058,416 (GRCm39) V195A probably damaging Het
Nsd3 G A 8: 26,204,230 (GRCm39) V420I Het
Or52e4 T C 7: 104,706,281 (GRCm39) L276P possibly damaging Het
Or52z13 A T 7: 103,247,225 (GRCm39) Q234L probably benign Het
Or5ac23 T C 16: 59,149,765 (GRCm39) I36V probably benign Het
Or5b99 T A 19: 12,976,983 (GRCm39) I211N probably damaging Het
Or5t9 A G 2: 86,659,098 (GRCm39) M1V probably null Het
Or6ae1 G A 7: 139,742,233 (GRCm39) T210I probably damaging Het
Or6c33 T C 10: 129,853,287 (GRCm39) I19T probably benign Het
Or8b56 A T 9: 38,739,014 (GRCm39) H3L probably benign Het
Pde10a G T 17: 9,020,710 (GRCm39) A216S unknown Het
Phldb2 T C 16: 45,645,247 (GRCm39) T400A possibly damaging Het
Pkd1l1 T A 11: 8,815,502 (GRCm39) T1920S Het
Ptgs2 T A 1: 149,981,419 (GRCm39) N567K probably benign Het
Pwp1 T A 10: 85,712,370 (GRCm39) D141E probably damaging Het
Rab3ip T C 10: 116,754,668 (GRCm39) E296G probably null Het
Rb1cc1 A G 1: 6,314,339 (GRCm39) K337R probably benign Het
Rbp3 A G 14: 33,677,477 (GRCm39) D475G probably damaging Het
Ric3 T C 7: 108,637,997 (GRCm39) E253G possibly damaging Het
Rictor A T 15: 6,797,562 (GRCm39) N306I possibly damaging Het
Rnf214 A T 9: 45,811,141 (GRCm39) V174E possibly damaging Het
Robo3 A G 9: 37,340,900 (GRCm39) F124S probably damaging Het
Rrad A G 8: 105,355,324 (GRCm39) F228S probably damaging Het
Scn3a A T 2: 65,291,595 (GRCm39) M1717K probably damaging Het
Scn3b A G 9: 40,193,729 (GRCm39) D152G probably benign Het
Scn5a C A 9: 119,315,803 (GRCm39) R1635L probably damaging Het
Sec61b A G 4: 47,483,049 (GRCm39) Y93C probably damaging Het
Shprh T A 10: 11,042,235 (GRCm39) Y739* probably null Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Slc26a7 T C 4: 14,519,496 (GRCm39) N508S probably benign Het
Slc7a12 A G 3: 14,564,360 (GRCm39) I349V possibly damaging Het
Slit1 T C 19: 41,596,874 (GRCm39) Y1075C probably damaging Het
Sltm C T 9: 70,480,841 (GRCm39) A231V unknown Het
Smg1 A G 7: 117,812,208 (GRCm39) S52P unknown Het
Sorl1 A G 9: 41,957,893 (GRCm39) Y584H probably damaging Het
Spmip2 A T 3: 79,356,616 (GRCm39) M140L probably benign Het
Ssbp1 T A 6: 40,454,968 (GRCm39) S142R probably benign Het
Stard3 A G 11: 98,270,797 (GRCm39) probably null Het
Strn3 G T 12: 51,674,300 (GRCm39) H531N possibly damaging Het
Stx17 A G 4: 48,180,739 (GRCm39) T195A probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tmed5 A C 5: 108,280,100 (GRCm39) probably null Het
Tmem132a C T 19: 10,838,960 (GRCm39) R494H probably benign Het
Tom1 A G 8: 75,787,177 (GRCm39) K406E probably benign Het
Trav5d-4 A T 14: 53,239,473 (GRCm39) N43Y probably damaging Het
Trbv19 G T 6: 41,155,945 (GRCm39) K105N possibly damaging Het
Trim34a C T 7: 103,910,328 (GRCm39) Q377* probably null Het
Trp53bp2 T A 1: 182,276,378 (GRCm39) N786K probably benign Het
Trpc3 A G 3: 36,705,683 (GRCm39) M504T probably benign Het
Ttc28 A T 5: 111,371,092 (GRCm39) M545L probably benign Het
Uggt1 A C 1: 36,204,627 (GRCm39) V996G possibly damaging Het
Vmn2r65 G A 7: 84,589,880 (GRCm39) Q679* probably null Het
Wdfy4 T C 14: 32,692,833 (GRCm39) I2958V Het
Zbtb37 C T 1: 160,847,840 (GRCm39) S389N possibly damaging Het
Zfp235 T C 7: 23,841,669 (GRCm39) V696A possibly damaging Het
Zzef1 T A 11: 72,765,732 (GRCm39) C1420S probably damaging Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCACAAATTACAAAGGTTGGACC -3'
(R):5'- CTGACAGTGTCGTACCATGTG -3'

Sequencing Primer
(F):5'- CTAGCTTTGACAGGCACTAGGTAC -3'
(R):5'- CAACAGACATCCTTAGTGG -3'
Posted On 2022-08-09