Incidental Mutation 'R9563:Zfp235'
ID 721210
Institutional Source Beutler Lab
Gene Symbol Zfp235
Ensembl Gene ENSMUSG00000047603
Gene Name zinc finger protein 235
Synonyms 0610030O19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9563 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 23833594-23842666 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23841669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 696 (V696A)
Ref Sequence ENSEMBL: ENSMUSP00000050803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056549] [ENSMUST00000205680]
AlphaFold Q499D5
Predicted Effect possibly damaging
Transcript: ENSMUST00000056549
AA Change: V696A

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050803
Gene: ENSMUSG00000047603
AA Change: V696A

DomainStartEndE-ValueType
KRAB 8 71 1.09e-15 SMART
ZnF_C2H2 283 305 1.79e-2 SMART
ZnF_C2H2 311 333 3.16e-3 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 6.99e-5 SMART
ZnF_C2H2 395 417 1.33e-1 SMART
ZnF_C2H2 423 445 3.16e-3 SMART
ZnF_C2H2 451 473 2.84e-5 SMART
ZnF_C2H2 479 501 6.32e-3 SMART
ZnF_C2H2 507 529 3.44e-4 SMART
ZnF_C2H2 535 557 2.12e-4 SMART
ZnF_C2H2 563 585 1.38e-3 SMART
ZnF_C2H2 591 613 2.27e-4 SMART
ZnF_C2H2 619 641 5.99e-4 SMART
ZnF_C2H2 647 669 5.9e-3 SMART
ZnF_C2H2 675 697 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205680
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein is a member of the Kruppel family of zinc finger proteins, and contains Kruppel-associated box (KRAB) A and B domains and 15 tandemly arrayed C2H2-type zinc fingers. It is an ortholog of the mouse Zfp93 protein. This gene is located in a cluster of zinc finger genes on 19q13.2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,645,009 (GRCm39) D953E probably damaging Het
Acod1 A C 14: 103,287,109 (GRCm39) Y80S probably damaging Het
Actr5 A G 2: 158,470,135 (GRCm39) D255G probably damaging Het
Akna A G 4: 63,312,944 (GRCm39) V393A probably damaging Het
Amotl1 T C 9: 14,473,513 (GRCm39) K562R possibly damaging Het
Amz1 T A 5: 140,738,133 (GRCm39) D464E probably damaging Het
Anapc1 G A 2: 128,505,980 (GRCm39) Q619* probably null Het
Arfgef3 C T 10: 18,522,275 (GRCm39) G584R probably damaging Het
Armt1 AC A 10: 4,400,848 (GRCm39) probably null Het
Atr G C 9: 95,802,833 (GRCm39) V1832L probably damaging Het
Bsn T C 9: 107,984,616 (GRCm39) D374G Het
Cap1 A G 4: 122,758,505 (GRCm39) V225A probably benign Het
Cc2d1a A G 8: 84,863,758 (GRCm39) S562P probably benign Het
Ccdc30 T C 4: 119,250,821 (GRCm39) N141S possibly damaging Het
Cdc42bpb A G 12: 111,265,762 (GRCm39) V1390A possibly damaging Het
Cdc42ep1 A T 15: 78,733,782 (GRCm39) H294L probably benign Het
Col6a6 C A 9: 105,572,952 (GRCm39) G2185C probably benign Het
Col7a1 T C 9: 108,791,809 (GRCm39) V1232A unknown Het
Copb1 A G 7: 113,836,034 (GRCm39) I449T possibly damaging Het
Cplane1 T G 15: 8,216,563 (GRCm39) L594V probably benign Het
Ctdsp2 A G 10: 126,832,040 (GRCm39) D216G probably damaging Het
Cttnbp2 T A 6: 18,367,382 (GRCm39) K1645N probably benign Het
Cttnbp2 A T 6: 18,427,467 (GRCm39) L738* probably null Het
Cul9 T A 17: 46,820,897 (GRCm39) T1927S probably benign Het
Cyfip2 A G 11: 46,151,707 (GRCm39) C531R probably benign Het
Cyp2j6 A G 4: 96,414,245 (GRCm39) I340T probably damaging Het
Daam1 A G 12: 71,992,251 (GRCm39) E322G unknown Het
Dab2ip T A 2: 35,609,915 (GRCm39) L710* probably null Het
Degs1l G T 1: 180,882,810 (GRCm39) V191F possibly damaging Het
Dph1 T C 11: 75,076,825 (GRCm39) T60A possibly damaging Het
Eme1 T C 11: 94,541,339 (GRCm39) D161G probably benign Het
Epha3 C T 16: 63,366,510 (GRCm39) G980D possibly damaging Het
Eri3 T A 4: 117,422,013 (GRCm39) V136E probably benign Het
Espl1 T A 15: 102,228,233 (GRCm39) I1669N possibly damaging Het
Exoc6 T C 19: 37,588,071 (GRCm39) I568T probably damaging Het
F3 T A 3: 121,527,822 (GRCm39) L85H Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbxw14 T C 9: 109,106,335 (GRCm39) Y234C probably benign Het
Fbxw25 T A 9: 109,483,676 (GRCm39) N179Y Het
Foxr1 T A 9: 44,352,199 (GRCm39) probably benign Het
Gas8 T A 8: 124,263,179 (GRCm39) V452E possibly damaging Het
Gdpd4 T C 7: 97,649,369 (GRCm39) V450A probably damaging Het
Greb1 T C 12: 16,774,824 (GRCm39) Y191C probably benign Het
H3c11 T C 13: 21,967,221 (GRCm39) D107G probably damaging Het
Haus3 G A 5: 34,325,300 (GRCm39) R120W probably benign Het
Herc1 G T 9: 66,294,193 (GRCm39) probably null Het
Hyal2 T C 9: 107,447,844 (GRCm39) W166R probably damaging Het
Inka1 T A 9: 107,861,488 (GRCm39) Y276F probably benign Het
Itga7 C T 10: 128,789,669 (GRCm39) A1003V probably damaging Het
Itga8 T A 2: 12,165,219 (GRCm39) I797F possibly damaging Het
Kank2 T C 9: 21,705,852 (GRCm39) T389A possibly damaging Het
Kcnb2 T A 1: 15,779,737 (GRCm39) I203N probably damaging Het
Kif21b T A 1: 136,077,166 (GRCm39) L396Q probably damaging Het
Kng1 T G 16: 22,879,170 (GRCm39) I78S probably damaging Het
Ldlrad4 T C 18: 68,387,551 (GRCm39) S288P probably benign Het
Lmntd2 A G 7: 140,790,701 (GRCm39) S516P Het
Lrp1b T A 2: 41,185,711 (GRCm39) I1449F Het
Lrrk2 T A 15: 91,634,043 (GRCm39) I1380K possibly damaging Het
Lvrn T G 18: 47,017,506 (GRCm39) I612S probably damaging Het
Lyst T C 13: 13,812,408 (GRCm39) L940P probably benign Het
Man2a2 T A 7: 80,006,101 (GRCm39) M996L probably benign Het
Map3k3 T A 11: 106,041,860 (GRCm39) I413N probably damaging Het
Map4k5 A G 12: 69,863,167 (GRCm39) V629A probably benign Het
Mapre2 A G 18: 24,023,981 (GRCm39) E325G unknown Het
Mbnl1 A G 3: 60,520,715 (GRCm39) N101S probably benign Het
Meltf T A 16: 31,703,869 (GRCm39) C199S probably damaging Het
Mmab T C 5: 114,574,850 (GRCm39) E141G probably benign Het
Mtcl2 G A 2: 156,902,182 (GRCm39) R278C probably damaging Het
Mtus2 T C 5: 148,250,217 (GRCm39) L1317P Het
Muc6 T A 7: 141,217,783 (GRCm39) T2297S possibly damaging Het
Myom2 A T 8: 15,158,399 (GRCm39) K784* probably null Het
Nek1 A G 8: 61,577,157 (GRCm39) E1118G probably benign Het
Nrtn A G 17: 57,058,416 (GRCm39) V195A probably damaging Het
Nsd3 G A 8: 26,204,230 (GRCm39) V420I Het
Or52e4 T C 7: 104,706,281 (GRCm39) L276P possibly damaging Het
Or52z13 A T 7: 103,247,225 (GRCm39) Q234L probably benign Het
Or5ac23 T C 16: 59,149,765 (GRCm39) I36V probably benign Het
Or5b99 T A 19: 12,976,983 (GRCm39) I211N probably damaging Het
Or5t9 A G 2: 86,659,098 (GRCm39) M1V probably null Het
Or6ae1 G A 7: 139,742,233 (GRCm39) T210I probably damaging Het
Or6c33 T C 10: 129,853,287 (GRCm39) I19T probably benign Het
Or8b56 A T 9: 38,739,014 (GRCm39) H3L probably benign Het
Pde10a G T 17: 9,020,710 (GRCm39) A216S unknown Het
Phldb2 T C 16: 45,645,247 (GRCm39) T400A possibly damaging Het
Pkd1l1 T A 11: 8,815,502 (GRCm39) T1920S Het
Ptgs2 T A 1: 149,981,419 (GRCm39) N567K probably benign Het
Pwp1 T A 10: 85,712,370 (GRCm39) D141E probably damaging Het
Rab3ip T C 10: 116,754,668 (GRCm39) E296G probably null Het
Rb1cc1 A G 1: 6,314,339 (GRCm39) K337R probably benign Het
Rbp3 A G 14: 33,677,477 (GRCm39) D475G probably damaging Het
Ric3 T C 7: 108,637,997 (GRCm39) E253G possibly damaging Het
Rictor A T 15: 6,797,562 (GRCm39) N306I possibly damaging Het
Rnf214 A T 9: 45,811,141 (GRCm39) V174E possibly damaging Het
Robo3 A G 9: 37,340,900 (GRCm39) F124S probably damaging Het
Rrad A G 8: 105,355,324 (GRCm39) F228S probably damaging Het
Scn3a A T 2: 65,291,595 (GRCm39) M1717K probably damaging Het
Scn3b A G 9: 40,193,729 (GRCm39) D152G probably benign Het
Scn5a C A 9: 119,315,803 (GRCm39) R1635L probably damaging Het
Sec61b A G 4: 47,483,049 (GRCm39) Y93C probably damaging Het
Shprh T A 10: 11,042,235 (GRCm39) Y739* probably null Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Slc26a7 T C 4: 14,519,496 (GRCm39) N508S probably benign Het
Slc7a12 A G 3: 14,564,360 (GRCm39) I349V possibly damaging Het
Slit1 T C 19: 41,596,874 (GRCm39) Y1075C probably damaging Het
Sltm C T 9: 70,480,841 (GRCm39) A231V unknown Het
Smg1 A G 7: 117,812,208 (GRCm39) S52P unknown Het
Sorl1 A G 9: 41,957,893 (GRCm39) Y584H probably damaging Het
Spmip2 A T 3: 79,356,616 (GRCm39) M140L probably benign Het
Ssbp1 T A 6: 40,454,968 (GRCm39) S142R probably benign Het
Stard3 A G 11: 98,270,797 (GRCm39) probably null Het
Strn3 G T 12: 51,674,300 (GRCm39) H531N possibly damaging Het
Stx17 A G 4: 48,180,739 (GRCm39) T195A probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tmed5 A C 5: 108,280,100 (GRCm39) probably null Het
Tmem132a C T 19: 10,838,960 (GRCm39) R494H probably benign Het
Tom1 A G 8: 75,787,177 (GRCm39) K406E probably benign Het
Trav5d-4 A T 14: 53,239,473 (GRCm39) N43Y probably damaging Het
Trbv19 G T 6: 41,155,945 (GRCm39) K105N possibly damaging Het
Trim34a C T 7: 103,910,328 (GRCm39) Q377* probably null Het
Trp53bp2 T A 1: 182,276,378 (GRCm39) N786K probably benign Het
Trpc3 A G 3: 36,705,683 (GRCm39) M504T probably benign Het
Ttc28 A T 5: 111,371,092 (GRCm39) M545L probably benign Het
Uggt1 A C 1: 36,204,627 (GRCm39) V996G possibly damaging Het
Vmn2r65 G A 7: 84,589,880 (GRCm39) Q679* probably null Het
Wdfy4 T C 14: 32,692,833 (GRCm39) I2958V Het
Zbtb37 C T 1: 160,847,840 (GRCm39) S389N possibly damaging Het
Zzef1 T A 11: 72,765,732 (GRCm39) C1420S probably damaging Het
Other mutations in Zfp235
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Zfp235 APN 7 23,836,505 (GRCm39) missense probably damaging 1.00
IGL02326:Zfp235 APN 7 23,834,727 (GRCm39) start codon destroyed probably null 0.98
R0107:Zfp235 UTSW 7 23,836,541 (GRCm39) missense probably damaging 1.00
R0271:Zfp235 UTSW 7 23,836,556 (GRCm39) missense possibly damaging 0.93
R0513:Zfp235 UTSW 7 23,841,644 (GRCm39) missense probably damaging 1.00
R1004:Zfp235 UTSW 7 23,840,169 (GRCm39) missense probably damaging 1.00
R1928:Zfp235 UTSW 7 23,840,563 (GRCm39) nonsense probably null
R1958:Zfp235 UTSW 7 23,839,771 (GRCm39) missense probably damaging 0.98
R2167:Zfp235 UTSW 7 23,840,387 (GRCm39) missense possibly damaging 0.80
R2511:Zfp235 UTSW 7 23,841,549 (GRCm39) missense probably damaging 1.00
R3013:Zfp235 UTSW 7 23,840,157 (GRCm39) missense probably damaging 0.98
R3806:Zfp235 UTSW 7 23,840,046 (GRCm39) missense probably benign 0.01
R4613:Zfp235 UTSW 7 23,841,101 (GRCm39) missense probably damaging 1.00
R4876:Zfp235 UTSW 7 23,840,384 (GRCm39) missense probably benign 0.01
R4977:Zfp235 UTSW 7 23,841,609 (GRCm39) missense possibly damaging 0.94
R5085:Zfp235 UTSW 7 23,836,546 (GRCm39) missense probably damaging 0.96
R5664:Zfp235 UTSW 7 23,841,576 (GRCm39) missense probably damaging 1.00
R6440:Zfp235 UTSW 7 23,840,040 (GRCm39) missense probably damaging 0.96
R6650:Zfp235 UTSW 7 23,836,463 (GRCm39) splice site probably null
R7694:Zfp235 UTSW 7 23,841,525 (GRCm39) missense probably benign 0.37
R8031:Zfp235 UTSW 7 23,841,114 (GRCm39) missense probably benign 0.19
R8188:Zfp235 UTSW 7 23,841,296 (GRCm39) missense probably damaging 1.00
R8744:Zfp235 UTSW 7 23,839,924 (GRCm39) missense possibly damaging 0.56
R9115:Zfp235 UTSW 7 23,841,453 (GRCm39) missense probably damaging 1.00
R9244:Zfp235 UTSW 7 23,839,919 (GRCm39) missense probably benign 0.00
R9401:Zfp235 UTSW 7 23,841,551 (GRCm39) missense probably damaging 1.00
R9404:Zfp235 UTSW 7 23,839,862 (GRCm39) missense possibly damaging 0.92
R9523:Zfp235 UTSW 7 23,840,381 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAAGCGATTCAGTCAGGC -3'
(R):5'- TAAAGAACTGATCTCCCAGCTG -3'

Sequencing Primer
(F):5'- GTTCATCAGATAATTCACACCGGGG -3'
(R):5'- TTCAAGGCTAGCCAGGTCTACAG -3'
Posted On 2022-08-09