Incidental Mutation 'R9563:Herc1'
ID 721238
Institutional Source Beutler Lab
Gene Symbol Herc1
Ensembl Gene ENSMUSG00000038664
Gene Name HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms tbl, D130015N03Rik, 2810449H11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9563 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 66350450-66508775 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 66386911 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042824]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000042824
SMART Domains Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:RCC1 476 526 5.4e-15 PFAM
Pfam:RCC1_2 513 542 1.3e-9 PFAM
Pfam:RCC1 529 576 5.5e-16 PFAM
Pfam:RCC1 579 629 1.5e-10 PFAM
Pfam:RCC1 632 680 3.6e-9 PFAM
Pfam:RCC1_2 667 696 2.2e-11 PFAM
Pfam:RCC1 683 733 1.2e-14 PFAM
low complexity region 787 807 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1080 1100 N/A INTRINSIC
low complexity region 1348 1378 N/A INTRINSIC
low complexity region 1659 1676 N/A INTRINSIC
low complexity region 1865 1874 N/A INTRINSIC
low complexity region 2002 2030 N/A INTRINSIC
SPRY 2067 2188 1.8e-30 SMART
coiled coil region 2251 2280 N/A INTRINSIC
low complexity region 2410 2423 N/A INTRINSIC
low complexity region 2613 2629 N/A INTRINSIC
low complexity region 2633 2648 N/A INTRINSIC
low complexity region 2650 2667 N/A INTRINSIC
low complexity region 2736 2749 N/A INTRINSIC
low complexity region 2882 2896 N/A INTRINSIC
low complexity region 2924 2935 N/A INTRINSIC
low complexity region 2971 2987 N/A INTRINSIC
low complexity region 3045 3051 N/A INTRINSIC
low complexity region 3168 3186 N/A INTRINSIC
low complexity region 3191 3213 N/A INTRINSIC
low complexity region 3364 3379 N/A INTRINSIC
WD40 3415 3454 1.68e-6 SMART
WD40 3570 3608 3.68e1 SMART
WD40 3613 3652 4.3e-1 SMART
WD40 3657 3702 3.17e-2 SMART
WD40 3734 3773 8.29e-6 SMART
low complexity region 3950 3964 N/A INTRINSIC
Pfam:RCC1_2 4079 4111 7.3e-9 PFAM
Pfam:RCC1 4098 4147 3.4e-16 PFAM
Pfam:RCC1_2 4134 4163 1.8e-7 PFAM
Pfam:RCC1 4150 4199 7.2e-16 PFAM
Pfam:RCC1 4204 4252 6.1e-12 PFAM
Pfam:RCC1 4255 4304 2.4e-7 PFAM
Pfam:RCC1_2 4291 4320 5.8e-12 PFAM
Pfam:RCC1 4307 4356 8.9e-16 PFAM
Blast:HECTc 4389 4423 2e-11 BLAST
HECTc 4497 4846 8.2e-148 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,187,079 L594V probably benign Het
9130409I23Rik G T 1: 181,055,245 V191F possibly damaging Het
A2m T A 6: 121,668,050 D953E probably damaging Het
Acod1 A C 14: 103,049,673 Y80S probably damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Akna A G 4: 63,394,707 V393A probably damaging Het
Amotl1 T C 9: 14,562,217 K562R possibly damaging Het
Amz1 T A 5: 140,752,378 D464E probably damaging Het
Anapc1 G A 2: 128,664,060 Q619* probably null Het
Arfgef3 C T 10: 18,646,527 G584R probably damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atr G C 9: 95,920,780 V1832L probably damaging Het
Bsn T C 9: 108,107,417 D374G Het
Cap1 A G 4: 122,864,712 V225A probably benign Het
Cc2d1a A G 8: 84,137,129 S562P probably benign Het
Ccdc30 T C 4: 119,393,624 N141S possibly damaging Het
Cdc42bpb A G 12: 111,299,328 V1390A possibly damaging Het
Cdc42ep1 A T 15: 78,849,582 H294L probably benign Het
Col6a6 C A 9: 105,695,753 G2185C probably benign Het
Col7a1 T C 9: 108,962,741 V1232A unknown Het
Copb1 A G 7: 114,236,799 I449T possibly damaging Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Cttnbp2 T A 6: 18,367,383 K1645N probably benign Het
Cttnbp2 A T 6: 18,427,468 L738* probably null Het
Cul9 T A 17: 46,509,971 T1927S probably benign Het
Cyfip2 A G 11: 46,260,880 C531R probably benign Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Daam1 A G 12: 71,945,477 E322G unknown Het
Dab2ip T A 2: 35,719,903 L710* probably null Het
Dph1 T C 11: 75,185,999 T60A possibly damaging Het
Eme1 T C 11: 94,650,513 D161G probably benign Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Eri3 T A 4: 117,564,816 V136E probably benign Het
Espl1 T A 15: 102,319,798 I1669N possibly damaging Het
Exoc6 T C 19: 37,599,623 I568T probably damaging Het
F3 T A 3: 121,734,173 L85H Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fam212a T A 9: 107,984,289 Y276F probably benign Het
Fbxw14 T C 9: 109,277,267 Y234C probably benign Het
Fbxw25 T A 9: 109,654,608 N179Y Het
Foxr1 T A 9: 44,440,902 probably benign Het
Gas8 T A 8: 123,536,440 V452E possibly damaging Het
Gdpd4 T C 7: 98,000,162 V450A probably damaging Het
Gm17359 A T 3: 79,449,309 M140L probably benign Het
Greb1 T C 12: 16,724,823 Y191C probably benign Het
Haus3 G A 5: 34,167,956 R120W probably benign Het
Hist1h3i T C 13: 21,783,051 D107G probably damaging Het
Hyal2 T C 9: 107,570,645 W166R probably damaging Het
Itga7 C T 10: 128,953,800 A1003V probably damaging Het
Itga8 T A 2: 12,160,408 I797F possibly damaging Het
Kank2 T C 9: 21,794,556 T389A possibly damaging Het
Kcnb2 T A 1: 15,709,513 I203N probably damaging Het
Kif21b T A 1: 136,149,428 L396Q probably damaging Het
Kng1 T G 16: 23,060,420 I78S probably damaging Het
Ldlrad4 T C 18: 68,254,480 S288P probably benign Het
Lmntd2 A G 7: 141,210,788 S516P Het
Lrp1b T A 2: 41,295,699 I1449F Het
Lrrk2 T A 15: 91,749,840 I1380K possibly damaging Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Lyst T C 13: 13,637,823 L940P probably benign Het
Man2a2 T A 7: 80,356,353 M996L probably benign Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Map4k5 A G 12: 69,816,393 V629A probably benign Het
Mapre2 A G 18: 23,890,924 E325G unknown Het
Mbnl1 A G 3: 60,613,294 N101S probably benign Het
Meltf T A 16: 31,885,051 C199S probably damaging Het
Mmab T C 5: 114,436,789 E141G probably benign Het
Mtus2 T C 5: 148,313,407 L1317P Het
Muc6 T A 7: 141,637,870 T2297S possibly damaging Het
Myom2 A T 8: 15,108,399 K784* probably null Het
Nek1 A G 8: 61,124,123 E1118G probably benign Het
Nrtn A G 17: 56,751,416 V195A probably damaging Het
Nsd3 G A 8: 25,714,203 V420I Het
Olfr1094 A G 2: 86,828,754 M1V probably null Het
Olfr1451 T A 19: 12,999,619 I211N probably damaging Het
Olfr205 T C 16: 59,329,402 I36V probably benign Het
Olfr522 G A 7: 140,162,320 T210I probably damaging Het
Olfr618 A T 7: 103,598,018 Q234L probably benign Het
Olfr677 T C 7: 105,057,074 L276P possibly damaging Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Olfr923 A T 9: 38,827,718 H3L probably benign Het
Pde10a G T 17: 8,801,878 A216S unknown Het
Phldb2 T C 16: 45,824,884 T400A possibly damaging Het
Pkd1l1 T A 11: 8,865,502 T1920S Het
Ptgs2 T A 1: 150,105,668 N567K probably benign Het
Pwp1 T A 10: 85,876,506 D141E probably damaging Het
Rab3ip T C 10: 116,918,763 E296G probably null Het
Rb1cc1 A G 1: 6,244,115 K337R probably benign Het
Rbp3 A G 14: 33,955,520 D475G probably damaging Het
Ric3 T C 7: 109,038,790 E253G possibly damaging Het
Rictor A T 15: 6,768,081 N306I possibly damaging Het
Rnf214 A T 9: 45,899,843 V174E possibly damaging Het
Robo3 A G 9: 37,429,604 F124S probably damaging Het
Rrad A G 8: 104,628,692 F228S probably damaging Het
Scn3a A T 2: 65,461,251 M1717K probably damaging Het
Scn3b A G 9: 40,282,433 D152G probably benign Het
Scn5a C A 9: 119,486,737 R1635L probably damaging Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Shprh T A 10: 11,166,491 Y739* probably null Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc26a7 T C 4: 14,519,496 N508S probably benign Het
Slc7a12 A G 3: 14,499,300 I349V possibly damaging Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Sltm C T 9: 70,573,559 A231V unknown Het
Smg1 A G 7: 118,212,985 S52P unknown Het
Soga1 G A 2: 157,060,262 R278C probably damaging Het
Sorl1 A G 9: 42,046,597 Y584H probably damaging Het
Ssbp1 T A 6: 40,478,034 S142R probably benign Het
Stard3 A G 11: 98,379,971 probably null Het
Strn3 G T 12: 51,627,517 H531N possibly damaging Het
Stx17 A G 4: 48,180,739 T195A probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tmed5 A C 5: 108,132,234 probably null Het
Tmem132a C T 19: 10,861,596 R494H probably benign Het
Tom1 A G 8: 75,060,549 K406E probably benign Het
Trav5d-4 A T 14: 53,002,016 N43Y probably damaging Het
Trbv19 G T 6: 41,179,011 K105N possibly damaging Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Trp53bp2 T A 1: 182,448,813 N786K probably benign Het
Trpc3 A G 3: 36,651,534 M504T probably benign Het
Ttc28 A T 5: 111,223,226 M545L probably benign Het
Uggt1 A C 1: 36,165,546 V996G possibly damaging Het
Vmn2r65 G A 7: 84,940,672 Q679* probably null Het
Wdfy4 T C 14: 32,970,876 I2958V Het
Zbtb37 C T 1: 161,020,270 S389N possibly damaging Het
Zfp235 T C 7: 24,142,244 V696A possibly damaging Het
Zzef1 T A 11: 72,874,906 C1420S probably damaging Het
Other mutations in Herc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Herc1 APN 9 66483966 missense probably benign 0.02
IGL00159:Herc1 APN 9 66437682 missense possibly damaging 0.94
IGL00486:Herc1 APN 9 66476120 missense probably benign
IGL00717:Herc1 APN 9 66485002 missense probably damaging 1.00
IGL00766:Herc1 APN 9 66450741 missense probably damaging 1.00
IGL00776:Herc1 APN 9 66421038 missense probably benign
IGL00987:Herc1 APN 9 66408052 missense probably benign 0.07
IGL01090:Herc1 APN 9 66469175 nonsense probably null
IGL01098:Herc1 APN 9 66461922 critical splice donor site probably null
IGL01106:Herc1 APN 9 66476438 splice site probably benign
IGL01120:Herc1 APN 9 66428880 missense probably benign
IGL01359:Herc1 APN 9 66439268 missense probably benign 0.01
IGL01360:Herc1 APN 9 66483699 missense probably benign
IGL01364:Herc1 APN 9 66399361 missense probably benign 0.00
IGL01470:Herc1 APN 9 66497636 missense possibly damaging 0.94
IGL01670:Herc1 APN 9 66487060 missense probably damaging 1.00
IGL01825:Herc1 APN 9 66399807 missense probably benign 0.00
IGL01903:Herc1 APN 9 66386872 nonsense probably null
IGL01988:Herc1 APN 9 66488075 splice site probably benign
IGL02074:Herc1 APN 9 66450983 missense probably benign
IGL02089:Herc1 APN 9 66480869 missense probably damaging 1.00
IGL02177:Herc1 APN 9 66434511 missense probably benign
IGL02300:Herc1 APN 9 66476363 missense probably benign 0.01
IGL02304:Herc1 APN 9 66476414 missense probably benign 0.06
IGL02369:Herc1 APN 9 66492011 nonsense probably null
IGL02445:Herc1 APN 9 66433482 missense possibly damaging 0.95
IGL02447:Herc1 APN 9 66497328 missense possibly damaging 0.59
IGL02549:Herc1 APN 9 66399901 missense probably damaging 0.98
IGL02571:Herc1 APN 9 66434605 splice site probably benign
IGL02709:Herc1 APN 9 66497680 missense probably damaging 0.97
IGL02717:Herc1 APN 9 66371921 nonsense probably null
IGL02726:Herc1 APN 9 66441988 missense probably benign 0.37
IGL02733:Herc1 APN 9 66450992 missense probably benign
IGL02963:Herc1 APN 9 66388823 missense probably damaging 0.99
IGL03101:Herc1 APN 9 66487997 missense probably benign
IGL03193:Herc1 APN 9 66402680 missense probably benign
IGL03203:Herc1 APN 9 66388900 critical splice donor site probably null
IGL03216:Herc1 APN 9 66478946 missense probably benign 0.06
IGL03282:Herc1 APN 9 66451459 missense probably benign 0.05
IGL03295:Herc1 APN 9 66396703 missense possibly damaging 0.56
cradle UTSW 9 66483866 splice site probably null
miracles UTSW 9 66462837 nonsense probably null
newton UTSW 9 66467803 missense probably damaging 1.00
R0907_Herc1_362 UTSW 9 66433428 missense possibly damaging 0.94
R4427_Herc1_231 UTSW 9 66496005 missense probably damaging 1.00
R5026_Herc1_363 UTSW 9 66486126 missense probably benign 0.03
stables UTSW 9 66479453 missense probably benign 0.13
strangle UTSW 9 66501188 frame shift probably null
IGL03134:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
PIT4243001:Herc1 UTSW 9 66372207 missense probably benign 0.00
PIT4486001:Herc1 UTSW 9 66372389 missense probably damaging 1.00
PIT4696001:Herc1 UTSW 9 66479009 missense probably damaging 1.00
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0052:Herc1 UTSW 9 66400156 missense probably damaging 0.99
R0114:Herc1 UTSW 9 66461846 missense probably damaging 0.99
R0129:Herc1 UTSW 9 66448075 missense probably damaging 1.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0132:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0158:Herc1 UTSW 9 66495921 nonsense probably null
R0333:Herc1 UTSW 9 66464699 splice site probably null
R0384:Herc1 UTSW 9 66481050 splice site probably benign
R0419:Herc1 UTSW 9 66446074 splice site probably benign
R0453:Herc1 UTSW 9 66399772 missense probably benign 0.20
R0458:Herc1 UTSW 9 66476381 missense probably benign 0.12
R0490:Herc1 UTSW 9 66484999 missense probably damaging 1.00
R0506:Herc1 UTSW 9 66448159 missense probably damaging 0.99
R0513:Herc1 UTSW 9 66445645 missense possibly damaging 0.96
R0628:Herc1 UTSW 9 66450881 missense probably benign 0.35
R0666:Herc1 UTSW 9 66484888 splice site probably benign
R0674:Herc1 UTSW 9 66501192 missense probably damaging 0.99
R0682:Herc1 UTSW 9 66481981 missense possibly damaging 0.95
R0690:Herc1 UTSW 9 66386838 nonsense probably null
R0701:Herc1 UTSW 9 66487950 missense probably damaging 1.00
R0766:Herc1 UTSW 9 66504840 missense probably damaging 1.00
R0850:Herc1 UTSW 9 66466670 missense probably damaging 1.00
R0907:Herc1 UTSW 9 66433428 missense possibly damaging 0.94
R0972:Herc1 UTSW 9 66372145 missense probably damaging 1.00
R0976:Herc1 UTSW 9 66439878 missense possibly damaging 0.74
R1027:Herc1 UTSW 9 66455968 missense probably benign
R1200:Herc1 UTSW 9 66486124 missense probably damaging 1.00
R1226:Herc1 UTSW 9 66416263 missense probably benign 0.00
R1364:Herc1 UTSW 9 66400093 missense probably damaging 1.00
R1395:Herc1 UTSW 9 66439181 missense probably benign 0.13
R1432:Herc1 UTSW 9 66465469 missense probably benign 0.13
R1440:Herc1 UTSW 9 66467803 missense probably damaging 1.00
R1476:Herc1 UTSW 9 66508266 missense probably damaging 1.00
R1590:Herc1 UTSW 9 66491953 splice site probably benign
R1634:Herc1 UTSW 9 66473538 missense possibly damaging 0.51
R1700:Herc1 UTSW 9 66450678 splice site probably null
R1753:Herc1 UTSW 9 66469010 missense probably damaging 1.00
R1753:Herc1 UTSW 9 66502084 critical splice donor site probably null
R1796:Herc1 UTSW 9 66388856 nonsense probably null
R1830:Herc1 UTSW 9 66497599 missense possibly damaging 0.95
R1855:Herc1 UTSW 9 66391426 missense possibly damaging 0.95
R1866:Herc1 UTSW 9 66450791 missense probably damaging 1.00
R1894:Herc1 UTSW 9 66479461 missense probably damaging 1.00
R1918:Herc1 UTSW 9 66476126 splice site probably null
R1999:Herc1 UTSW 9 66486078 missense probably benign 0.07
R2034:Herc1 UTSW 9 66441972 missense probably benign 0.01
R2138:Herc1 UTSW 9 66470307 missense possibly damaging 0.94
R2186:Herc1 UTSW 9 66439901 missense probably benign 0.45
R2192:Herc1 UTSW 9 66465406 missense probably damaging 0.99
R2312:Herc1 UTSW 9 66508281 nonsense probably null
R2338:Herc1 UTSW 9 66428969 missense possibly damaging 0.69
R3035:Herc1 UTSW 9 66483935 missense possibly damaging 0.89
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3733:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3917:Herc1 UTSW 9 66434466 missense possibly damaging 0.94
R3953:Herc1 UTSW 9 66433793 nonsense probably null
R4073:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4075:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4241:Herc1 UTSW 9 66448348 frame shift probably null
R4260:Herc1 UTSW 9 66448348 frame shift probably null
R4261:Herc1 UTSW 9 66448348 frame shift probably null
R4300:Herc1 UTSW 9 66489406 missense probably damaging 1.00
R4398:Herc1 UTSW 9 66479453 missense probably benign 0.13
R4426:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4427:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4590:Herc1 UTSW 9 66437664 missense probably damaging 0.97
R4630:Herc1 UTSW 9 66433714 splice site probably null
R4656:Herc1 UTSW 9 66394711 missense probably damaging 0.97
R4658:Herc1 UTSW 9 66479491 missense possibly damaging 0.50
R4663:Herc1 UTSW 9 66433378 missense probably damaging 0.98
R4675:Herc1 UTSW 9 66391458 missense probably damaging 1.00
R4678:Herc1 UTSW 9 66416269 missense probably benign 0.00
R4754:Herc1 UTSW 9 66501206 missense probably benign 0.00
R4766:Herc1 UTSW 9 66441929 missense probably benign 0.00
R4792:Herc1 UTSW 9 66495984 missense possibly damaging 0.67
R4828:Herc1 UTSW 9 66497343 splice site probably null
R4832:Herc1 UTSW 9 66495971 missense probably benign 0.11
R4879:Herc1 UTSW 9 66462837 nonsense probably null
R4948:Herc1 UTSW 9 66484902 missense probably benign
R5021:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5022:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5023:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5024:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5025:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5026:Herc1 UTSW 9 66486126 missense probably benign 0.03
R5027:Herc1 UTSW 9 66473529 missense probably benign 0.01
R5027:Herc1 UTSW 9 66504618 missense probably damaging 0.98
R5038:Herc1 UTSW 9 66476460 intron probably benign
R5041:Herc1 UTSW 9 66429045 missense possibly damaging 0.86
R5053:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5137:Herc1 UTSW 9 66448223 missense probably benign
R5197:Herc1 UTSW 9 66448504 missense probably damaging 0.99
R5207:Herc1 UTSW 9 66399869 nonsense probably null
R5247:Herc1 UTSW 9 66434551 missense probably benign 0.01
R5267:Herc1 UTSW 9 66461809 missense probably damaging 1.00
R5274:Herc1 UTSW 9 66399409 missense probably benign
R5375:Herc1 UTSW 9 66467887 missense probably damaging 0.99
R5401:Herc1 UTSW 9 66502056 missense probably damaging 1.00
R5560:Herc1 UTSW 9 66451119 missense probably benign 0.02
R5566:Herc1 UTSW 9 66465537 missense possibly damaging 0.95
R5577:Herc1 UTSW 9 66481981 missense probably damaging 0.99
R5596:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
R5665:Herc1 UTSW 9 66465435 missense probably damaging 1.00
R5744:Herc1 UTSW 9 66508193 missense probably damaging 1.00
R5802:Herc1 UTSW 9 66462878 missense probably damaging 1.00
R5822:Herc1 UTSW 9 66445612 missense probably benign 0.00
R5954:Herc1 UTSW 9 66451492 splice site probably benign
R5977:Herc1 UTSW 9 66433322 missense possibly damaging 0.77
R6022:Herc1 UTSW 9 66483685 missense probably damaging 1.00
R6043:Herc1 UTSW 9 66408154 missense probably benign
R6046:Herc1 UTSW 9 66445549 missense probably damaging 0.99
R6089:Herc1 UTSW 9 66445532 missense probably damaging 1.00
R6123:Herc1 UTSW 9 66497250 missense probably damaging 0.97
R6155:Herc1 UTSW 9 66433423 missense possibly damaging 0.95
R6190:Herc1 UTSW 9 66376381 missense possibly damaging 0.56
R6220:Herc1 UTSW 9 66433788 missense probably damaging 1.00
R6265:Herc1 UTSW 9 66372016 missense probably benign 0.05
R6348:Herc1 UTSW 9 66487976 missense possibly damaging 0.77
R6362:Herc1 UTSW 9 66471908 missense probably damaging 1.00
R6394:Herc1 UTSW 9 66395059 missense probably damaging 0.99
R6434:Herc1 UTSW 9 66486182 missense probably damaging 0.99
R6483:Herc1 UTSW 9 66448529 missense possibly damaging 0.64
R6607:Herc1 UTSW 9 66418567 missense probably benign 0.02
R6633:Herc1 UTSW 9 66439252 nonsense probably null
R6634:Herc1 UTSW 9 66437744 missense probably benign
R6693:Herc1 UTSW 9 66478976 missense probably damaging 0.99
R6695:Herc1 UTSW 9 66483866 splice site probably null
R6748:Herc1 UTSW 9 66501188 frame shift probably null
R6750:Herc1 UTSW 9 66501188 frame shift probably null
R6751:Herc1 UTSW 9 66501188 frame shift probably null
R6774:Herc1 UTSW 9 66501188 frame shift probably null
R6785:Herc1 UTSW 9 66501188 frame shift probably null
R6786:Herc1 UTSW 9 66501188 frame shift probably null
R6856:Herc1 UTSW 9 66397898 missense probably benign 0.05
R6966:Herc1 UTSW 9 66411065 missense probably benign 0.07
R7020:Herc1 UTSW 9 66486078 missense probably benign 0.07
R7109:Herc1 UTSW 9 66481889 missense probably benign 0.03
R7122:Herc1 UTSW 9 66399774 missense possibly damaging 0.69
R7209:Herc1 UTSW 9 66385032 missense possibly damaging 0.95
R7222:Herc1 UTSW 9 66467499 missense probably damaging 0.98
R7303:Herc1 UTSW 9 66450816 missense possibly damaging 0.93
R7305:Herc1 UTSW 9 66461868 missense
R7438:Herc1 UTSW 9 66394756 missense probably benign 0.00
R7535:Herc1 UTSW 9 66474853 missense probably damaging 1.00
R7585:Herc1 UTSW 9 66445547 missense probably damaging 1.00
R7603:Herc1 UTSW 9 66451383 nonsense probably null
R7670:Herc1 UTSW 9 66416347 missense probably damaging 0.99
R7705:Herc1 UTSW 9 66439834 missense possibly damaging 0.86
R7723:Herc1 UTSW 9 66371876 missense probably benign 0.24
R7730:Herc1 UTSW 9 66493190 small deletion probably benign
R7880:Herc1 UTSW 9 66508224 missense probably damaging 0.99
R7958:Herc1 UTSW 9 66486193 missense probably damaging 1.00
R7976:Herc1 UTSW 9 66434270 missense possibly damaging 0.94
R8006:Herc1 UTSW 9 66445560 nonsense probably null
R8084:Herc1 UTSW 9 66475935 missense probably benign 0.45
R8094:Herc1 UTSW 9 66493180 missense probably damaging 0.98
R8099:Herc1 UTSW 9 66372140 missense probably damaging 1.00
R8151:Herc1 UTSW 9 66433791 missense probably damaging 0.98
R8159:Herc1 UTSW 9 66461721 missense probably null
R8190:Herc1 UTSW 9 66418451 missense probably benign 0.00
R8213:Herc1 UTSW 9 66450888 missense probably damaging 0.99
R8230:Herc1 UTSW 9 66470316 missense probably damaging 0.99
R8265:Herc1 UTSW 9 66386704 nonsense probably null
R8270:Herc1 UTSW 9 66487950 missense probably damaging 1.00
R8353:Herc1 UTSW 9 66508289 missense possibly damaging 0.88
R8423:Herc1 UTSW 9 66508160 missense probably damaging 0.99
R8506:Herc1 UTSW 9 66473581 missense possibly damaging 0.52
R8523:Herc1 UTSW 9 66450942 missense probably benign
R8530:Herc1 UTSW 9 66418628 missense probably benign
R8545:Herc1 UTSW 9 66371975 nonsense probably null
R8682:Herc1 UTSW 9 66462848 missense
R8720:Herc1 UTSW 9 66481823 missense probably benign 0.38
R8792:Herc1 UTSW 9 66465486 missense probably damaging 1.00
R8915:Herc1 UTSW 9 66411174 missense probably damaging 1.00
R8964:Herc1 UTSW 9 66445590 missense probably damaging 1.00
R9056:Herc1 UTSW 9 66473500 missense probably benign 0.10
R9158:Herc1 UTSW 9 66469118 missense probably benign 0.00
R9167:Herc1 UTSW 9 66504618 missense possibly damaging 0.75
R9192:Herc1 UTSW 9 66414131 missense probably benign 0.35
R9252:Herc1 UTSW 9 66402552 missense probably damaging 1.00
R9260:Herc1 UTSW 9 66418409 nonsense probably null
R9261:Herc1 UTSW 9 66504847 missense probably damaging 0.98
R9430:Herc1 UTSW 9 66418503 nonsense probably null
R9519:Herc1 UTSW 9 66400074 missense probably damaging 0.97
R9589:Herc1 UTSW 9 66465558 missense possibly damaging 0.95
R9600:Herc1 UTSW 9 66397312 missense possibly damaging 0.95
RF023:Herc1 UTSW 9 66458334 missense
X0011:Herc1 UTSW 9 66400159 missense probably benign 0.28
X0067:Herc1 UTSW 9 66448524 missense probably benign 0.03
Z1176:Herc1 UTSW 9 66434576 missense probably benign
Z1177:Herc1 UTSW 9 66458425 missense probably null
Z1177:Herc1 UTSW 9 66471911 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGCCTCACCGGTCTATTAAG -3'
(R):5'- GACTAACCTCACATGTCCCC -3'

Sequencing Primer
(F):5'- CCTCACCGGTCTATTAAGAAAGTTTC -3'
(R):5'- TAACCTCACATGTCCCCACACAC -3'
Posted On 2022-08-09