Incidental Mutation 'R9563:Sltm'
ID 721239
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene Name SAFB-like, transcription modulator
Synonyms 9130215G10Rik, 5730555F13Rik, 5730455C01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock # R9563 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 70542754-70592234 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70573559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 231 (A231V)
Ref Sequence ENSEMBL: ENSMUSP00000049112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000213808] [ENSMUST00000216816] [ENSMUST00000217593]
AlphaFold Q8CH25
Predicted Effect unknown
Transcript: ENSMUST00000049263
AA Change: A231V
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: A231V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213808
Predicted Effect unknown
Transcript: ENSMUST00000216816
AA Change: A213V
Predicted Effect probably benign
Transcript: ENSMUST00000217593
AA Change: A231V

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,187,079 L594V probably benign Het
9130409I23Rik G T 1: 181,055,245 V191F possibly damaging Het
A2m T A 6: 121,668,050 D953E probably damaging Het
Acod1 A C 14: 103,049,673 Y80S probably damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Akna A G 4: 63,394,707 V393A probably damaging Het
Amotl1 T C 9: 14,562,217 K562R possibly damaging Het
Amz1 T A 5: 140,752,378 D464E probably damaging Het
Anapc1 G A 2: 128,664,060 Q619* probably null Het
Arfgef3 C T 10: 18,646,527 G584R probably damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atr G C 9: 95,920,780 V1832L probably damaging Het
Bsn T C 9: 108,107,417 D374G Het
Cap1 A G 4: 122,864,712 V225A probably benign Het
Cc2d1a A G 8: 84,137,129 S562P probably benign Het
Ccdc30 T C 4: 119,393,624 N141S possibly damaging Het
Cdc42bpb A G 12: 111,299,328 V1390A possibly damaging Het
Cdc42ep1 A T 15: 78,849,582 H294L probably benign Het
Col6a6 C A 9: 105,695,753 G2185C probably benign Het
Col7a1 T C 9: 108,962,741 V1232A unknown Het
Copb1 A G 7: 114,236,799 I449T possibly damaging Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Cttnbp2 T A 6: 18,367,383 K1645N probably benign Het
Cttnbp2 A T 6: 18,427,468 L738* probably null Het
Cul9 T A 17: 46,509,971 T1927S probably benign Het
Cyfip2 A G 11: 46,260,880 C531R probably benign Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Daam1 A G 12: 71,945,477 E322G unknown Het
Dab2ip T A 2: 35,719,903 L710* probably null Het
Dph1 T C 11: 75,185,999 T60A possibly damaging Het
Eme1 T C 11: 94,650,513 D161G probably benign Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Eri3 T A 4: 117,564,816 V136E probably benign Het
Espl1 T A 15: 102,319,798 I1669N possibly damaging Het
Exoc6 T C 19: 37,599,623 I568T probably damaging Het
F3 T A 3: 121,734,173 L85H Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fam212a T A 9: 107,984,289 Y276F probably benign Het
Fbxw14 T C 9: 109,277,267 Y234C probably benign Het
Fbxw25 T A 9: 109,654,608 N179Y Het
Foxr1 T A 9: 44,440,902 probably benign Het
Gas8 T A 8: 123,536,440 V452E possibly damaging Het
Gdpd4 T C 7: 98,000,162 V450A probably damaging Het
Gm17359 A T 3: 79,449,309 M140L probably benign Het
Greb1 T C 12: 16,724,823 Y191C probably benign Het
Haus3 G A 5: 34,167,956 R120W probably benign Het
Herc1 G T 9: 66,386,911 probably null Het
Hist1h3i T C 13: 21,783,051 D107G probably damaging Het
Hyal2 T C 9: 107,570,645 W166R probably damaging Het
Itga7 C T 10: 128,953,800 A1003V probably damaging Het
Itga8 T A 2: 12,160,408 I797F possibly damaging Het
Kank2 T C 9: 21,794,556 T389A possibly damaging Het
Kcnb2 T A 1: 15,709,513 I203N probably damaging Het
Kif21b T A 1: 136,149,428 L396Q probably damaging Het
Kng1 T G 16: 23,060,420 I78S probably damaging Het
Ldlrad4 T C 18: 68,254,480 S288P probably benign Het
Lmntd2 A G 7: 141,210,788 S516P Het
Lrp1b T A 2: 41,295,699 I1449F Het
Lrrk2 T A 15: 91,749,840 I1380K possibly damaging Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Lyst T C 13: 13,637,823 L940P probably benign Het
Man2a2 T A 7: 80,356,353 M996L probably benign Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Map4k5 A G 12: 69,816,393 V629A probably benign Het
Mapre2 A G 18: 23,890,924 E325G unknown Het
Mbnl1 A G 3: 60,613,294 N101S probably benign Het
Meltf T A 16: 31,885,051 C199S probably damaging Het
Mmab T C 5: 114,436,789 E141G probably benign Het
Mtus2 T C 5: 148,313,407 L1317P Het
Muc6 T A 7: 141,637,870 T2297S possibly damaging Het
Myom2 A T 8: 15,108,399 K784* probably null Het
Nek1 A G 8: 61,124,123 E1118G probably benign Het
Nrtn A G 17: 56,751,416 V195A probably damaging Het
Nsd3 G A 8: 25,714,203 V420I Het
Olfr1094 A G 2: 86,828,754 M1V probably null Het
Olfr1451 T A 19: 12,999,619 I211N probably damaging Het
Olfr205 T C 16: 59,329,402 I36V probably benign Het
Olfr522 G A 7: 140,162,320 T210I probably damaging Het
Olfr618 A T 7: 103,598,018 Q234L probably benign Het
Olfr677 T C 7: 105,057,074 L276P possibly damaging Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Olfr923 A T 9: 38,827,718 H3L probably benign Het
Pde10a G T 17: 8,801,878 A216S unknown Het
Phldb2 T C 16: 45,824,884 T400A possibly damaging Het
Pkd1l1 T A 11: 8,865,502 T1920S Het
Ptgs2 T A 1: 150,105,668 N567K probably benign Het
Pwp1 T A 10: 85,876,506 D141E probably damaging Het
Rab3ip T C 10: 116,918,763 E296G probably null Het
Rb1cc1 A G 1: 6,244,115 K337R probably benign Het
Rbp3 A G 14: 33,955,520 D475G probably damaging Het
Ric3 T C 7: 109,038,790 E253G possibly damaging Het
Rictor A T 15: 6,768,081 N306I possibly damaging Het
Rnf214 A T 9: 45,899,843 V174E possibly damaging Het
Robo3 A G 9: 37,429,604 F124S probably damaging Het
Rrad A G 8: 104,628,692 F228S probably damaging Het
Scn3a A T 2: 65,461,251 M1717K probably damaging Het
Scn3b A G 9: 40,282,433 D152G probably benign Het
Scn5a C A 9: 119,486,737 R1635L probably damaging Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Shprh T A 10: 11,166,491 Y739* probably null Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc26a7 T C 4: 14,519,496 N508S probably benign Het
Slc7a12 A G 3: 14,499,300 I349V possibly damaging Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Smg1 A G 7: 118,212,985 S52P unknown Het
Soga1 G A 2: 157,060,262 R278C probably damaging Het
Sorl1 A G 9: 42,046,597 Y584H probably damaging Het
Ssbp1 T A 6: 40,478,034 S142R probably benign Het
Stard3 A G 11: 98,379,971 probably null Het
Strn3 G T 12: 51,627,517 H531N possibly damaging Het
Stx17 A G 4: 48,180,739 T195A probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tmed5 A C 5: 108,132,234 probably null Het
Tmem132a C T 19: 10,861,596 R494H probably benign Het
Tom1 A G 8: 75,060,549 K406E probably benign Het
Trav5d-4 A T 14: 53,002,016 N43Y probably damaging Het
Trbv19 G T 6: 41,179,011 K105N possibly damaging Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Trp53bp2 T A 1: 182,448,813 N786K probably benign Het
Trpc3 A G 3: 36,651,534 M504T probably benign Het
Ttc28 A T 5: 111,223,226 M545L probably benign Het
Uggt1 A C 1: 36,165,546 V996G possibly damaging Het
Vmn2r65 G A 7: 84,940,672 Q679* probably null Het
Wdfy4 T C 14: 32,970,876 I2958V Het
Zbtb37 C T 1: 161,020,270 S389N possibly damaging Het
Zfp235 T C 7: 24,142,244 V696A possibly damaging Het
Zzef1 T A 11: 72,874,906 C1420S probably damaging Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
R9541:Sltm UTSW 9 70573775 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCATCAGTGCTAATGACTGGC -3'
(R):5'- GGGTTCATCTCATAATCCTTGGC -3'

Sequencing Primer
(F):5'- AGGTCCTATTCTAGCTTATGAATGTG -3'
(R):5'- TCTCCGGGCTCTGTGCAATG -3'
Posted On 2022-08-09