Incidental Mutation 'R9563:Rab3ip'
ID 721253
Institutional Source Beutler Lab
Gene Symbol Rab3ip
Ensembl Gene ENSMUSG00000064181
Gene Name RAB3A interacting protein
Synonyms Rabin3, Gtpat12, SSX2 interacting protein
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9563 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 116905784-116950769 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116918763 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 296 (E296G)
Ref Sequence ENSEMBL: ENSMUSP00000151708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020375] [ENSMUST00000219109]
AlphaFold Q68EF0
Predicted Effect probably damaging
Transcript: ENSMUST00000020375
AA Change: E264G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020375
Gene: ENSMUSG00000064181
AA Change: E264G

DomainStartEndE-ValueType
low complexity region 84 100 N/A INTRINSIC
PDB:4LHZ|F 157 200 9e-15 PDB
low complexity region 213 220 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219109
AA Change: E296G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are fertile and show no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,187,079 L594V probably benign Het
9130409I23Rik G T 1: 181,055,245 V191F possibly damaging Het
A2m T A 6: 121,668,050 D953E probably damaging Het
Acod1 A C 14: 103,049,673 Y80S probably damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Akna A G 4: 63,394,707 V393A probably damaging Het
Amotl1 T C 9: 14,562,217 K562R possibly damaging Het
Amz1 T A 5: 140,752,378 D464E probably damaging Het
Anapc1 G A 2: 128,664,060 Q619* probably null Het
Arfgef3 C T 10: 18,646,527 G584R probably damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atr G C 9: 95,920,780 V1832L probably damaging Het
Bsn T C 9: 108,107,417 D374G Het
Cap1 A G 4: 122,864,712 V225A probably benign Het
Cc2d1a A G 8: 84,137,129 S562P probably benign Het
Ccdc30 T C 4: 119,393,624 N141S possibly damaging Het
Cdc42bpb A G 12: 111,299,328 V1390A possibly damaging Het
Cdc42ep1 A T 15: 78,849,582 H294L probably benign Het
Col6a6 C A 9: 105,695,753 G2185C probably benign Het
Col7a1 T C 9: 108,962,741 V1232A unknown Het
Copb1 A G 7: 114,236,799 I449T possibly damaging Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Cttnbp2 T A 6: 18,367,383 K1645N probably benign Het
Cttnbp2 A T 6: 18,427,468 L738* probably null Het
Cul9 T A 17: 46,509,971 T1927S probably benign Het
Cyfip2 A G 11: 46,260,880 C531R probably benign Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Daam1 A G 12: 71,945,477 E322G unknown Het
Dab2ip T A 2: 35,719,903 L710* probably null Het
Dph1 T C 11: 75,185,999 T60A possibly damaging Het
Eme1 T C 11: 94,650,513 D161G probably benign Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Eri3 T A 4: 117,564,816 V136E probably benign Het
Espl1 T A 15: 102,319,798 I1669N possibly damaging Het
Exoc6 T C 19: 37,599,623 I568T probably damaging Het
F3 T A 3: 121,734,173 L85H Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fam212a T A 9: 107,984,289 Y276F probably benign Het
Fbxw14 T C 9: 109,277,267 Y234C probably benign Het
Fbxw25 T A 9: 109,654,608 N179Y Het
Foxr1 T A 9: 44,440,902 probably benign Het
Gas8 T A 8: 123,536,440 V452E possibly damaging Het
Gdpd4 T C 7: 98,000,162 V450A probably damaging Het
Gm17359 A T 3: 79,449,309 M140L probably benign Het
Greb1 T C 12: 16,724,823 Y191C probably benign Het
Haus3 G A 5: 34,167,956 R120W probably benign Het
Herc1 G T 9: 66,386,911 probably null Het
Hist1h3i T C 13: 21,783,051 D107G probably damaging Het
Hyal2 T C 9: 107,570,645 W166R probably damaging Het
Itga7 C T 10: 128,953,800 A1003V probably damaging Het
Itga8 T A 2: 12,160,408 I797F possibly damaging Het
Kank2 T C 9: 21,794,556 T389A possibly damaging Het
Kcnb2 T A 1: 15,709,513 I203N probably damaging Het
Kif21b T A 1: 136,149,428 L396Q probably damaging Het
Kng1 T G 16: 23,060,420 I78S probably damaging Het
Ldlrad4 T C 18: 68,254,480 S288P probably benign Het
Lmntd2 A G 7: 141,210,788 S516P Het
Lrp1b T A 2: 41,295,699 I1449F Het
Lrrk2 T A 15: 91,749,840 I1380K possibly damaging Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Lyst T C 13: 13,637,823 L940P probably benign Het
Man2a2 T A 7: 80,356,353 M996L probably benign Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Map4k5 A G 12: 69,816,393 V629A probably benign Het
Mapre2 A G 18: 23,890,924 E325G unknown Het
Mbnl1 A G 3: 60,613,294 N101S probably benign Het
Meltf T A 16: 31,885,051 C199S probably damaging Het
Mmab T C 5: 114,436,789 E141G probably benign Het
Mtus2 T C 5: 148,313,407 L1317P Het
Muc6 T A 7: 141,637,870 T2297S possibly damaging Het
Myom2 A T 8: 15,108,399 K784* probably null Het
Nek1 A G 8: 61,124,123 E1118G probably benign Het
Nrtn A G 17: 56,751,416 V195A probably damaging Het
Nsd3 G A 8: 25,714,203 V420I Het
Olfr1094 A G 2: 86,828,754 M1V probably null Het
Olfr1451 T A 19: 12,999,619 I211N probably damaging Het
Olfr205 T C 16: 59,329,402 I36V probably benign Het
Olfr522 G A 7: 140,162,320 T210I probably damaging Het
Olfr618 A T 7: 103,598,018 Q234L probably benign Het
Olfr677 T C 7: 105,057,074 L276P possibly damaging Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Olfr923 A T 9: 38,827,718 H3L probably benign Het
Pde10a G T 17: 8,801,878 A216S unknown Het
Phldb2 T C 16: 45,824,884 T400A possibly damaging Het
Pkd1l1 T A 11: 8,865,502 T1920S Het
Ptgs2 T A 1: 150,105,668 N567K probably benign Het
Pwp1 T A 10: 85,876,506 D141E probably damaging Het
Rb1cc1 A G 1: 6,244,115 K337R probably benign Het
Rbp3 A G 14: 33,955,520 D475G probably damaging Het
Ric3 T C 7: 109,038,790 E253G possibly damaging Het
Rictor A T 15: 6,768,081 N306I possibly damaging Het
Rnf214 A T 9: 45,899,843 V174E possibly damaging Het
Robo3 A G 9: 37,429,604 F124S probably damaging Het
Rrad A G 8: 104,628,692 F228S probably damaging Het
Scn3a A T 2: 65,461,251 M1717K probably damaging Het
Scn3b A G 9: 40,282,433 D152G probably benign Het
Scn5a C A 9: 119,486,737 R1635L probably damaging Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Shprh T A 10: 11,166,491 Y739* probably null Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc26a7 T C 4: 14,519,496 N508S probably benign Het
Slc7a12 A G 3: 14,499,300 I349V possibly damaging Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Sltm C T 9: 70,573,559 A231V unknown Het
Smg1 A G 7: 118,212,985 S52P unknown Het
Soga1 G A 2: 157,060,262 R278C probably damaging Het
Sorl1 A G 9: 42,046,597 Y584H probably damaging Het
Ssbp1 T A 6: 40,478,034 S142R probably benign Het
Stard3 A G 11: 98,379,971 probably null Het
Strn3 G T 12: 51,627,517 H531N possibly damaging Het
Stx17 A G 4: 48,180,739 T195A probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tmed5 A C 5: 108,132,234 probably null Het
Tmem132a C T 19: 10,861,596 R494H probably benign Het
Tom1 A G 8: 75,060,549 K406E probably benign Het
Trav5d-4 A T 14: 53,002,016 N43Y probably damaging Het
Trbv19 G T 6: 41,179,011 K105N possibly damaging Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Trp53bp2 T A 1: 182,448,813 N786K probably benign Het
Trpc3 A G 3: 36,651,534 M504T probably benign Het
Ttc28 A T 5: 111,223,226 M545L probably benign Het
Uggt1 A C 1: 36,165,546 V996G possibly damaging Het
Vmn2r65 G A 7: 84,940,672 Q679* probably null Het
Wdfy4 T C 14: 32,970,876 I2958V Het
Zbtb37 C T 1: 161,020,270 S389N possibly damaging Het
Zfp235 T C 7: 24,142,244 V696A possibly damaging Het
Zzef1 T A 11: 72,874,906 C1420S probably damaging Het
Other mutations in Rab3ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Rab3ip APN 10 116907092 missense probably benign 0.09
IGL01946:Rab3ip APN 10 116937395 critical splice donor site probably null
IGL02665:Rab3ip APN 10 116937548 missense probably benign 0.02
R1538:Rab3ip UTSW 10 116939254 missense probably damaging 1.00
R1565:Rab3ip UTSW 10 116939223 missense probably benign 0.09
R1760:Rab3ip UTSW 10 116937510 missense probably damaging 1.00
R2077:Rab3ip UTSW 10 116918960 missense possibly damaging 0.87
R4441:Rab3ip UTSW 10 116915932 missense probably benign 0.19
R5442:Rab3ip UTSW 10 116918848 missense probably benign
R5526:Rab3ip UTSW 10 116918929 missense possibly damaging 0.61
R5682:Rab3ip UTSW 10 116907103 nonsense probably null
R5921:Rab3ip UTSW 10 116939247 missense probably damaging 1.00
R6254:Rab3ip UTSW 10 116915867 missense probably damaging 1.00
R7021:Rab3ip UTSW 10 116939378 missense probably damaging 1.00
R7026:Rab3ip UTSW 10 116937536 missense probably benign 0.18
R7326:Rab3ip UTSW 10 116937633 missense probably benign 0.07
R7408:Rab3ip UTSW 10 116937641 missense possibly damaging 0.62
R7655:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R7656:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R8363:Rab3ip UTSW 10 116918964 missense probably damaging 1.00
R8537:Rab3ip UTSW 10 116910154 missense probably damaging 1.00
R9085:Rab3ip UTSW 10 116939405 missense probably damaging 1.00
R9086:Rab3ip UTSW 10 116939405 missense probably damaging 1.00
R9161:Rab3ip UTSW 10 116914161 missense probably damaging 1.00
R9451:Rab3ip UTSW 10 116939449 start codon destroyed probably null 0.97
R9564:Rab3ip UTSW 10 116915875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACGCATGCCACTTTATTC -3'
(R):5'- GACACTCGTACTGTCCAGTTC -3'

Sequencing Primer
(F):5'- ACTTGAAATGCAGAGACTCCTG -3'
(R):5'- AGTTCTCCAACATCGCCTACG -3'
Posted On 2022-08-09