Incidental Mutation 'R9563:Cplane1'
ID 721276
Institutional Source Beutler Lab
Gene Symbol Cplane1
Ensembl Gene ENSMUSG00000039801
Gene Name ciliogenesis and planar polarity effector 1
Synonyms Hug, 2410089E03Rik, b2b012Clo, Jbts17
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9563 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 8198590-8300642 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 8216563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 594 (L594V)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110617
AA Change: L594V

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: L594V

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,645,009 (GRCm39) D953E probably damaging Het
Acod1 A C 14: 103,287,109 (GRCm39) Y80S probably damaging Het
Actr5 A G 2: 158,470,135 (GRCm39) D255G probably damaging Het
Akna A G 4: 63,312,944 (GRCm39) V393A probably damaging Het
Amotl1 T C 9: 14,473,513 (GRCm39) K562R possibly damaging Het
Amz1 T A 5: 140,738,133 (GRCm39) D464E probably damaging Het
Anapc1 G A 2: 128,505,980 (GRCm39) Q619* probably null Het
Arfgef3 C T 10: 18,522,275 (GRCm39) G584R probably damaging Het
Armt1 AC A 10: 4,400,848 (GRCm39) probably null Het
Atr G C 9: 95,802,833 (GRCm39) V1832L probably damaging Het
Bsn T C 9: 107,984,616 (GRCm39) D374G Het
Cap1 A G 4: 122,758,505 (GRCm39) V225A probably benign Het
Cc2d1a A G 8: 84,863,758 (GRCm39) S562P probably benign Het
Ccdc30 T C 4: 119,250,821 (GRCm39) N141S possibly damaging Het
Cdc42bpb A G 12: 111,265,762 (GRCm39) V1390A possibly damaging Het
Cdc42ep1 A T 15: 78,733,782 (GRCm39) H294L probably benign Het
Col6a6 C A 9: 105,572,952 (GRCm39) G2185C probably benign Het
Col7a1 T C 9: 108,791,809 (GRCm39) V1232A unknown Het
Copb1 A G 7: 113,836,034 (GRCm39) I449T possibly damaging Het
Ctdsp2 A G 10: 126,832,040 (GRCm39) D216G probably damaging Het
Cttnbp2 T A 6: 18,367,382 (GRCm39) K1645N probably benign Het
Cttnbp2 A T 6: 18,427,467 (GRCm39) L738* probably null Het
Cul9 T A 17: 46,820,897 (GRCm39) T1927S probably benign Het
Cyfip2 A G 11: 46,151,707 (GRCm39) C531R probably benign Het
Cyp2j6 A G 4: 96,414,245 (GRCm39) I340T probably damaging Het
Daam1 A G 12: 71,992,251 (GRCm39) E322G unknown Het
Dab2ip T A 2: 35,609,915 (GRCm39) L710* probably null Het
Degs1l G T 1: 180,882,810 (GRCm39) V191F possibly damaging Het
Dph1 T C 11: 75,076,825 (GRCm39) T60A possibly damaging Het
Eme1 T C 11: 94,541,339 (GRCm39) D161G probably benign Het
Epha3 C T 16: 63,366,510 (GRCm39) G980D possibly damaging Het
Eri3 T A 4: 117,422,013 (GRCm39) V136E probably benign Het
Espl1 T A 15: 102,228,233 (GRCm39) I1669N possibly damaging Het
Exoc6 T C 19: 37,588,071 (GRCm39) I568T probably damaging Het
F3 T A 3: 121,527,822 (GRCm39) L85H Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbxw14 T C 9: 109,106,335 (GRCm39) Y234C probably benign Het
Fbxw25 T A 9: 109,483,676 (GRCm39) N179Y Het
Foxr1 T A 9: 44,352,199 (GRCm39) probably benign Het
Gas8 T A 8: 124,263,179 (GRCm39) V452E possibly damaging Het
Gdpd4 T C 7: 97,649,369 (GRCm39) V450A probably damaging Het
Greb1 T C 12: 16,774,824 (GRCm39) Y191C probably benign Het
H3c11 T C 13: 21,967,221 (GRCm39) D107G probably damaging Het
Haus3 G A 5: 34,325,300 (GRCm39) R120W probably benign Het
Herc1 G T 9: 66,294,193 (GRCm39) probably null Het
Hyal2 T C 9: 107,447,844 (GRCm39) W166R probably damaging Het
Inka1 T A 9: 107,861,488 (GRCm39) Y276F probably benign Het
Itga7 C T 10: 128,789,669 (GRCm39) A1003V probably damaging Het
Itga8 T A 2: 12,165,219 (GRCm39) I797F possibly damaging Het
Kank2 T C 9: 21,705,852 (GRCm39) T389A possibly damaging Het
Kcnb2 T A 1: 15,779,737 (GRCm39) I203N probably damaging Het
Kif21b T A 1: 136,077,166 (GRCm39) L396Q probably damaging Het
Kng1 T G 16: 22,879,170 (GRCm39) I78S probably damaging Het
Ldlrad4 T C 18: 68,387,551 (GRCm39) S288P probably benign Het
Lmntd2 A G 7: 140,790,701 (GRCm39) S516P Het
Lrp1b T A 2: 41,185,711 (GRCm39) I1449F Het
Lrrk2 T A 15: 91,634,043 (GRCm39) I1380K possibly damaging Het
Lvrn T G 18: 47,017,506 (GRCm39) I612S probably damaging Het
Lyst T C 13: 13,812,408 (GRCm39) L940P probably benign Het
Man2a2 T A 7: 80,006,101 (GRCm39) M996L probably benign Het
Map3k3 T A 11: 106,041,860 (GRCm39) I413N probably damaging Het
Map4k5 A G 12: 69,863,167 (GRCm39) V629A probably benign Het
Mapre2 A G 18: 24,023,981 (GRCm39) E325G unknown Het
Mbnl1 A G 3: 60,520,715 (GRCm39) N101S probably benign Het
Meltf T A 16: 31,703,869 (GRCm39) C199S probably damaging Het
Mmab T C 5: 114,574,850 (GRCm39) E141G probably benign Het
Mtcl2 G A 2: 156,902,182 (GRCm39) R278C probably damaging Het
Mtus2 T C 5: 148,250,217 (GRCm39) L1317P Het
Muc6 T A 7: 141,217,783 (GRCm39) T2297S possibly damaging Het
Myom2 A T 8: 15,158,399 (GRCm39) K784* probably null Het
Nek1 A G 8: 61,577,157 (GRCm39) E1118G probably benign Het
Nrtn A G 17: 57,058,416 (GRCm39) V195A probably damaging Het
Nsd3 G A 8: 26,204,230 (GRCm39) V420I Het
Or52e4 T C 7: 104,706,281 (GRCm39) L276P possibly damaging Het
Or52z13 A T 7: 103,247,225 (GRCm39) Q234L probably benign Het
Or5ac23 T C 16: 59,149,765 (GRCm39) I36V probably benign Het
Or5b99 T A 19: 12,976,983 (GRCm39) I211N probably damaging Het
Or5t9 A G 2: 86,659,098 (GRCm39) M1V probably null Het
Or6ae1 G A 7: 139,742,233 (GRCm39) T210I probably damaging Het
Or6c33 T C 10: 129,853,287 (GRCm39) I19T probably benign Het
Or8b56 A T 9: 38,739,014 (GRCm39) H3L probably benign Het
Pde10a G T 17: 9,020,710 (GRCm39) A216S unknown Het
Phldb2 T C 16: 45,645,247 (GRCm39) T400A possibly damaging Het
Pkd1l1 T A 11: 8,815,502 (GRCm39) T1920S Het
Ptgs2 T A 1: 149,981,419 (GRCm39) N567K probably benign Het
Pwp1 T A 10: 85,712,370 (GRCm39) D141E probably damaging Het
Rab3ip T C 10: 116,754,668 (GRCm39) E296G probably null Het
Rb1cc1 A G 1: 6,314,339 (GRCm39) K337R probably benign Het
Rbp3 A G 14: 33,677,477 (GRCm39) D475G probably damaging Het
Ric3 T C 7: 108,637,997 (GRCm39) E253G possibly damaging Het
Rictor A T 15: 6,797,562 (GRCm39) N306I possibly damaging Het
Rnf214 A T 9: 45,811,141 (GRCm39) V174E possibly damaging Het
Robo3 A G 9: 37,340,900 (GRCm39) F124S probably damaging Het
Rrad A G 8: 105,355,324 (GRCm39) F228S probably damaging Het
Scn3a A T 2: 65,291,595 (GRCm39) M1717K probably damaging Het
Scn3b A G 9: 40,193,729 (GRCm39) D152G probably benign Het
Scn5a C A 9: 119,315,803 (GRCm39) R1635L probably damaging Het
Sec61b A G 4: 47,483,049 (GRCm39) Y93C probably damaging Het
Shprh T A 10: 11,042,235 (GRCm39) Y739* probably null Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Slc26a7 T C 4: 14,519,496 (GRCm39) N508S probably benign Het
Slc7a12 A G 3: 14,564,360 (GRCm39) I349V possibly damaging Het
Slit1 T C 19: 41,596,874 (GRCm39) Y1075C probably damaging Het
Sltm C T 9: 70,480,841 (GRCm39) A231V unknown Het
Smg1 A G 7: 117,812,208 (GRCm39) S52P unknown Het
Sorl1 A G 9: 41,957,893 (GRCm39) Y584H probably damaging Het
Spmip2 A T 3: 79,356,616 (GRCm39) M140L probably benign Het
Ssbp1 T A 6: 40,454,968 (GRCm39) S142R probably benign Het
Stard3 A G 11: 98,270,797 (GRCm39) probably null Het
Strn3 G T 12: 51,674,300 (GRCm39) H531N possibly damaging Het
Stx17 A G 4: 48,180,739 (GRCm39) T195A probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tmed5 A C 5: 108,280,100 (GRCm39) probably null Het
Tmem132a C T 19: 10,838,960 (GRCm39) R494H probably benign Het
Tom1 A G 8: 75,787,177 (GRCm39) K406E probably benign Het
Trav5d-4 A T 14: 53,239,473 (GRCm39) N43Y probably damaging Het
Trbv19 G T 6: 41,155,945 (GRCm39) K105N possibly damaging Het
Trim34a C T 7: 103,910,328 (GRCm39) Q377* probably null Het
Trp53bp2 T A 1: 182,276,378 (GRCm39) N786K probably benign Het
Trpc3 A G 3: 36,705,683 (GRCm39) M504T probably benign Het
Ttc28 A T 5: 111,371,092 (GRCm39) M545L probably benign Het
Uggt1 A C 1: 36,204,627 (GRCm39) V996G possibly damaging Het
Vmn2r65 G A 7: 84,589,880 (GRCm39) Q679* probably null Het
Wdfy4 T C 14: 32,692,833 (GRCm39) I2958V Het
Zbtb37 C T 1: 160,847,840 (GRCm39) S389N possibly damaging Het
Zfp235 T C 7: 23,841,669 (GRCm39) V696A possibly damaging Het
Zzef1 T A 11: 72,765,732 (GRCm39) C1420S probably damaging Het
Other mutations in Cplane1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Cplane1 APN 15 8,293,931 (GRCm39) splice site probably benign
IGL00766:Cplane1 APN 15 8,281,648 (GRCm39) missense unknown
IGL01483:Cplane1 APN 15 8,216,591 (GRCm39) missense probably damaging 0.98
IGL01520:Cplane1 APN 15 8,251,395 (GRCm39) missense probably damaging 0.96
IGL01578:Cplane1 APN 15 8,300,194 (GRCm39) missense unknown
IGL01701:Cplane1 APN 15 8,232,741 (GRCm39) splice site probably benign
IGL01892:Cplane1 APN 15 8,271,749 (GRCm39) splice site probably benign
IGL01895:Cplane1 APN 15 8,258,591 (GRCm39) missense possibly damaging 0.63
IGL01922:Cplane1 APN 15 8,300,305 (GRCm39) missense unknown
IGL01978:Cplane1 APN 15 8,248,866 (GRCm39) missense probably damaging 0.98
IGL02031:Cplane1 APN 15 8,209,253 (GRCm39) missense probably damaging 0.99
IGL02318:Cplane1 APN 15 8,204,509 (GRCm39) missense probably damaging 0.98
IGL02321:Cplane1 APN 15 8,246,056 (GRCm39) missense probably benign 0.04
IGL02363:Cplane1 APN 15 8,247,921 (GRCm39) missense possibly damaging 0.68
IGL02404:Cplane1 APN 15 8,216,768 (GRCm39) missense possibly damaging 0.48
IGL02535:Cplane1 APN 15 8,204,322 (GRCm39) missense probably damaging 1.00
IGL02732:Cplane1 APN 15 8,209,375 (GRCm39) missense probably benign 0.03
IGL02895:Cplane1 APN 15 8,261,591 (GRCm39) splice site probably benign
IGL02903:Cplane1 APN 15 8,299,262 (GRCm39) missense unknown
IGL02903:Cplane1 APN 15 8,299,263 (GRCm39) missense unknown
IGL02979:Cplane1 APN 15 8,248,038 (GRCm39) missense possibly damaging 0.82
IGL03077:Cplane1 APN 15 8,242,279 (GRCm39) splice site probably benign
IGL03196:Cplane1 APN 15 8,230,826 (GRCm39) missense probably damaging 0.98
IGL03344:Cplane1 APN 15 8,216,942 (GRCm39) missense possibly damaging 0.63
IGL03368:Cplane1 APN 15 8,251,857 (GRCm39) missense probably benign 0.06
IGL03403:Cplane1 APN 15 8,230,826 (GRCm39) missense probably damaging 0.98
agnes UTSW 15 8,276,422 (GRCm39) nonsense probably null
dei UTSW 15 8,215,649 (GRCm39) missense probably damaging 1.00
R0015:Cplane1 UTSW 15 8,215,668 (GRCm39) missense probably damaging 1.00
R0015:Cplane1 UTSW 15 8,215,668 (GRCm39) missense probably damaging 1.00
R0101:Cplane1 UTSW 15 8,250,444 (GRCm39) missense probably benign 0.00
R0105:Cplane1 UTSW 15 8,216,876 (GRCm39) missense probably benign
R0105:Cplane1 UTSW 15 8,216,876 (GRCm39) missense probably benign
R0165:Cplane1 UTSW 15 8,245,866 (GRCm39) missense probably damaging 1.00
R0306:Cplane1 UTSW 15 8,209,373 (GRCm39) missense probably damaging 1.00
R0433:Cplane1 UTSW 15 8,246,046 (GRCm39) missense probably benign 0.00
R0491:Cplane1 UTSW 15 8,211,727 (GRCm39) missense probably damaging 1.00
R0523:Cplane1 UTSW 15 8,223,870 (GRCm39) missense probably damaging 1.00
R0571:Cplane1 UTSW 15 8,289,277 (GRCm39) missense unknown
R0679:Cplane1 UTSW 15 8,252,606 (GRCm39) missense probably benign 0.39
R0704:Cplane1 UTSW 15 8,239,567 (GRCm39) missense possibly damaging 0.93
R0707:Cplane1 UTSW 15 8,287,805 (GRCm39) missense unknown
R0715:Cplane1 UTSW 15 8,252,576 (GRCm39) missense probably benign 0.14
R0762:Cplane1 UTSW 15 8,247,900 (GRCm39) unclassified probably benign
R0830:Cplane1 UTSW 15 8,276,669 (GRCm39) missense unknown
R0924:Cplane1 UTSW 15 8,280,554 (GRCm39) splice site probably benign
R1071:Cplane1 UTSW 15 8,247,910 (GRCm39) missense probably benign 0.20
R1184:Cplane1 UTSW 15 8,245,971 (GRCm39) missense probably benign
R1224:Cplane1 UTSW 15 8,207,869 (GRCm39) missense probably benign 0.06
R1416:Cplane1 UTSW 15 8,276,422 (GRCm39) nonsense probably null
R1428:Cplane1 UTSW 15 8,248,853 (GRCm39) missense possibly damaging 0.83
R1487:Cplane1 UTSW 15 8,215,715 (GRCm39) missense probably damaging 1.00
R1641:Cplane1 UTSW 15 8,258,443 (GRCm39) missense probably benign 0.41
R1652:Cplane1 UTSW 15 8,230,630 (GRCm39) missense probably damaging 1.00
R1688:Cplane1 UTSW 15 8,258,093 (GRCm39) missense probably benign 0.00
R1715:Cplane1 UTSW 15 8,256,384 (GRCm39) splice site probably null
R1820:Cplane1 UTSW 15 8,299,129 (GRCm39) missense unknown
R1863:Cplane1 UTSW 15 8,258,077 (GRCm39) missense probably benign 0.00
R1940:Cplane1 UTSW 15 8,263,336 (GRCm39) missense probably damaging 0.98
R1967:Cplane1 UTSW 15 8,232,904 (GRCm39) missense probably benign 0.09
R2064:Cplane1 UTSW 15 8,215,649 (GRCm39) missense probably damaging 1.00
R2076:Cplane1 UTSW 15 8,248,741 (GRCm39) missense possibly damaging 0.93
R2163:Cplane1 UTSW 15 8,232,735 (GRCm39) splice site probably null
R2208:Cplane1 UTSW 15 8,223,887 (GRCm39) missense probably benign 0.33
R2504:Cplane1 UTSW 15 8,248,700 (GRCm39) missense probably damaging 0.99
R2568:Cplane1 UTSW 15 8,230,753 (GRCm39) missense possibly damaging 0.70
R2845:Cplane1 UTSW 15 8,245,864 (GRCm39) missense probably damaging 1.00
R2913:Cplane1 UTSW 15 8,300,169 (GRCm39) missense unknown
R3056:Cplane1 UTSW 15 8,280,491 (GRCm39) missense unknown
R3706:Cplane1 UTSW 15 8,289,300 (GRCm39) missense unknown
R3707:Cplane1 UTSW 15 8,289,300 (GRCm39) missense unknown
R3870:Cplane1 UTSW 15 8,247,948 (GRCm39) missense probably damaging 0.98
R3877:Cplane1 UTSW 15 8,251,427 (GRCm39) missense probably benign
R3886:Cplane1 UTSW 15 8,201,289 (GRCm39) missense probably damaging 0.98
R4057:Cplane1 UTSW 15 8,248,509 (GRCm39) missense probably benign 0.08
R4090:Cplane1 UTSW 15 8,241,842 (GRCm39) splice site probably null
R4362:Cplane1 UTSW 15 8,300,229 (GRCm39) missense unknown
R4363:Cplane1 UTSW 15 8,300,229 (GRCm39) missense unknown
R4445:Cplane1 UTSW 15 8,281,672 (GRCm39) missense unknown
R4581:Cplane1 UTSW 15 8,201,282 (GRCm39) missense possibly damaging 0.85
R4587:Cplane1 UTSW 15 8,230,636 (GRCm39) missense possibly damaging 0.50
R4659:Cplane1 UTSW 15 8,245,760 (GRCm39) intron probably benign
R4663:Cplane1 UTSW 15 8,247,939 (GRCm39) missense probably benign 0.31
R4779:Cplane1 UTSW 15 8,248,322 (GRCm39) missense probably benign 0.04
R4812:Cplane1 UTSW 15 8,230,607 (GRCm39) splice site probably null
R4850:Cplane1 UTSW 15 8,292,422 (GRCm39) missense unknown
R4896:Cplane1 UTSW 15 8,251,421 (GRCm39) missense probably benign 0.00
R5273:Cplane1 UTSW 15 8,292,422 (GRCm39) missense unknown
R5273:Cplane1 UTSW 15 8,273,825 (GRCm39) missense probably damaging 0.98
R5303:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5307:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5308:Cplane1 UTSW 15 8,290,174 (GRCm39) splice site probably null
R5373:Cplane1 UTSW 15 8,300,287 (GRCm39) missense unknown
R5374:Cplane1 UTSW 15 8,300,287 (GRCm39) missense unknown
R5386:Cplane1 UTSW 15 8,223,897 (GRCm39) missense probably damaging 1.00
R5534:Cplane1 UTSW 15 8,258,319 (GRCm39) missense probably benign 0.06
R5720:Cplane1 UTSW 15 8,233,171 (GRCm39) missense probably benign 0.35
R5891:Cplane1 UTSW 15 8,218,073 (GRCm39) missense probably benign 0.00
R5932:Cplane1 UTSW 15 8,274,079 (GRCm39) splice site probably null
R6053:Cplane1 UTSW 15 8,217,945 (GRCm39) missense probably benign 0.35
R6166:Cplane1 UTSW 15 8,216,044 (GRCm39) missense probably benign 0.00
R6245:Cplane1 UTSW 15 8,207,902 (GRCm39) missense probably benign 0.01
R6246:Cplane1 UTSW 15 8,239,498 (GRCm39) missense probably damaging 1.00
R6541:Cplane1 UTSW 15 8,248,779 (GRCm39) missense possibly damaging 0.48
R6622:Cplane1 UTSW 15 8,273,706 (GRCm39) missense probably damaging 0.98
R6707:Cplane1 UTSW 15 8,252,606 (GRCm39) missense probably benign 0.39
R6729:Cplane1 UTSW 15 8,218,085 (GRCm39) splice site probably null
R6805:Cplane1 UTSW 15 8,273,790 (GRCm39) missense probably benign 0.07
R6806:Cplane1 UTSW 15 8,216,342 (GRCm39) missense possibly damaging 0.55
R6813:Cplane1 UTSW 15 8,258,766 (GRCm39) missense probably benign
R6830:Cplane1 UTSW 15 8,205,668 (GRCm39) missense probably benign 0.04
R6845:Cplane1 UTSW 15 8,251,388 (GRCm39) missense possibly damaging 0.84
R6894:Cplane1 UTSW 15 8,216,852 (GRCm39) missense probably damaging 0.99
R6970:Cplane1 UTSW 15 8,217,032 (GRCm39) missense probably benign 0.01
R6991:Cplane1 UTSW 15 8,281,690 (GRCm39) missense unknown
R7003:Cplane1 UTSW 15 8,258,246 (GRCm39) missense probably damaging 0.99
R7088:Cplane1 UTSW 15 8,248,431 (GRCm39) missense probably benign 0.16
R7104:Cplane1 UTSW 15 8,223,928 (GRCm39) missense possibly damaging 0.83
R7311:Cplane1 UTSW 15 8,210,399 (GRCm39) missense probably damaging 1.00
R7374:Cplane1 UTSW 15 8,276,731 (GRCm39) missense unknown
R7446:Cplane1 UTSW 15 8,261,564 (GRCm39) missense probably damaging 0.98
R7539:Cplane1 UTSW 15 8,230,728 (GRCm39) missense probably benign 0.19
R7543:Cplane1 UTSW 15 8,254,876 (GRCm39) missense unknown
R7558:Cplane1 UTSW 15 8,254,851 (GRCm39) missense unknown
R7629:Cplane1 UTSW 15 8,256,551 (GRCm39) nonsense probably null
R7635:Cplane1 UTSW 15 8,256,404 (GRCm39) missense probably benign 0.01
R7644:Cplane1 UTSW 15 8,252,611 (GRCm39) missense probably benign 0.00
R7705:Cplane1 UTSW 15 8,211,736 (GRCm39) missense probably damaging 1.00
R7752:Cplane1 UTSW 15 8,299,190 (GRCm39) missense unknown
R7754:Cplane1 UTSW 15 8,273,310 (GRCm39) missense possibly damaging 0.53
R7757:Cplane1 UTSW 15 8,281,711 (GRCm39) missense unknown
R7836:Cplane1 UTSW 15 8,233,241 (GRCm39) missense probably damaging 0.97
R7875:Cplane1 UTSW 15 8,239,446 (GRCm39) missense probably benign 0.18
R7901:Cplane1 UTSW 15 8,299,190 (GRCm39) missense unknown
R7983:Cplane1 UTSW 15 8,251,299 (GRCm39) missense probably benign 0.01
R8030:Cplane1 UTSW 15 8,259,787 (GRCm39) missense probably damaging 1.00
R8088:Cplane1 UTSW 15 8,215,802 (GRCm39) missense probably benign 0.00
R8231:Cplane1 UTSW 15 8,248,511 (GRCm39) missense probably benign 0.16
R8443:Cplane1 UTSW 15 8,230,635 (GRCm39) missense probably benign 0.03
R8480:Cplane1 UTSW 15 8,216,942 (GRCm39) missense possibly damaging 0.63
R8693:Cplane1 UTSW 15 8,258,492 (GRCm39) missense probably benign 0.15
R8785:Cplane1 UTSW 15 8,204,244 (GRCm39) missense probably benign 0.39
R8791:Cplane1 UTSW 15 8,216,744 (GRCm39) missense probably damaging 1.00
R8822:Cplane1 UTSW 15 8,201,262 (GRCm39) missense probably damaging 1.00
R8831:Cplane1 UTSW 15 8,211,620 (GRCm39) missense probably benign 0.09
R8932:Cplane1 UTSW 15 8,223,859 (GRCm39) missense probably damaging 1.00
R8968:Cplane1 UTSW 15 8,230,765 (GRCm39) missense possibly damaging 0.84
R8973:Cplane1 UTSW 15 8,233,277 (GRCm39) missense probably damaging 1.00
R9036:Cplane1 UTSW 15 8,252,622 (GRCm39) missense possibly damaging 0.63
R9134:Cplane1 UTSW 15 8,228,716 (GRCm39) missense probably damaging 0.99
R9197:Cplane1 UTSW 15 8,280,536 (GRCm39) missense unknown
R9259:Cplane1 UTSW 15 8,232,787 (GRCm39) missense possibly damaging 0.82
R9269:Cplane1 UTSW 15 8,248,500 (GRCm39) missense probably damaging 0.97
R9294:Cplane1 UTSW 15 8,232,811 (GRCm39) missense probably benign 0.00
R9328:Cplane1 UTSW 15 8,215,692 (GRCm39) missense probably damaging 1.00
R9680:Cplane1 UTSW 15 8,231,785 (GRCm39) missense possibly damaging 0.68
R9721:Cplane1 UTSW 15 8,254,893 (GRCm39) missense unknown
R9779:Cplane1 UTSW 15 8,230,786 (GRCm39) missense possibly damaging 0.93
R9780:Cplane1 UTSW 15 8,258,123 (GRCm39) missense probably benign 0.00
U24488:Cplane1 UTSW 15 8,211,694 (GRCm39) missense probably damaging 1.00
X0023:Cplane1 UTSW 15 8,276,515 (GRCm39) missense unknown
Z1177:Cplane1 UTSW 15 8,239,473 (GRCm39) missense probably damaging 0.98
Z1177:Cplane1 UTSW 15 8,204,456 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCGATATTGTCAAGGAAGG -3'
(R):5'- AAGAGCTTTACAGTATTTGCGG -3'

Sequencing Primer
(F):5'- AAGGAAGATTGGAGTTTGCATCTATG -3'
(R):5'- TGAGCCTTATCAAGTGGCCCATG -3'
Posted On 2022-08-09