Incidental Mutation 'R9563:2410089E03Rik'
ID 721276
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene Name RIKEN cDNA 2410089E03 gene
Synonyms b2b012Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9563 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 8169106-8271158 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 8187079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 594 (L594V)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110617
AA Change: L594V

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: L594V

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik G T 1: 181,055,245 V191F possibly damaging Het
A2m T A 6: 121,668,050 D953E probably damaging Het
Acod1 A C 14: 103,049,673 Y80S probably damaging Het
Actr5 A G 2: 158,628,215 D255G probably damaging Het
Akna A G 4: 63,394,707 V393A probably damaging Het
Amotl1 T C 9: 14,562,217 K562R possibly damaging Het
Amz1 T A 5: 140,752,378 D464E probably damaging Het
Anapc1 G A 2: 128,664,060 Q619* probably null Het
Arfgef3 C T 10: 18,646,527 G584R probably damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atr G C 9: 95,920,780 V1832L probably damaging Het
Bsn T C 9: 108,107,417 D374G Het
Cap1 A G 4: 122,864,712 V225A probably benign Het
Cc2d1a A G 8: 84,137,129 S562P probably benign Het
Ccdc30 T C 4: 119,393,624 N141S possibly damaging Het
Cdc42bpb A G 12: 111,299,328 V1390A possibly damaging Het
Cdc42ep1 A T 15: 78,849,582 H294L probably benign Het
Col6a6 C A 9: 105,695,753 G2185C probably benign Het
Col7a1 T C 9: 108,962,741 V1232A unknown Het
Copb1 A G 7: 114,236,799 I449T possibly damaging Het
Ctdsp2 A G 10: 126,996,171 D216G probably damaging Het
Cttnbp2 T A 6: 18,367,383 K1645N probably benign Het
Cttnbp2 A T 6: 18,427,468 L738* probably null Het
Cul9 T A 17: 46,509,971 T1927S probably benign Het
Cyfip2 A G 11: 46,260,880 C531R probably benign Het
Cyp2j6 A G 4: 96,526,008 I340T probably damaging Het
Daam1 A G 12: 71,945,477 E322G unknown Het
Dab2ip T A 2: 35,719,903 L710* probably null Het
Dph1 T C 11: 75,185,999 T60A possibly damaging Het
Eme1 T C 11: 94,650,513 D161G probably benign Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Eri3 T A 4: 117,564,816 V136E probably benign Het
Espl1 T A 15: 102,319,798 I1669N possibly damaging Het
Exoc6 T C 19: 37,599,623 I568T probably damaging Het
F3 T A 3: 121,734,173 L85H Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fam212a T A 9: 107,984,289 Y276F probably benign Het
Fbxw14 T C 9: 109,277,267 Y234C probably benign Het
Fbxw25 T A 9: 109,654,608 N179Y Het
Foxr1 T A 9: 44,440,902 probably benign Het
Gas8 T A 8: 123,536,440 V452E possibly damaging Het
Gdpd4 T C 7: 98,000,162 V450A probably damaging Het
Gm17359 A T 3: 79,449,309 M140L probably benign Het
Greb1 T C 12: 16,724,823 Y191C probably benign Het
Haus3 G A 5: 34,167,956 R120W probably benign Het
Herc1 G T 9: 66,386,911 probably null Het
Hist1h3i T C 13: 21,783,051 D107G probably damaging Het
Hyal2 T C 9: 107,570,645 W166R probably damaging Het
Itga7 C T 10: 128,953,800 A1003V probably damaging Het
Itga8 T A 2: 12,160,408 I797F possibly damaging Het
Kank2 T C 9: 21,794,556 T389A possibly damaging Het
Kcnb2 T A 1: 15,709,513 I203N probably damaging Het
Kif21b T A 1: 136,149,428 L396Q probably damaging Het
Kng1 T G 16: 23,060,420 I78S probably damaging Het
Ldlrad4 T C 18: 68,254,480 S288P probably benign Het
Lmntd2 A G 7: 141,210,788 S516P Het
Lrp1b T A 2: 41,295,699 I1449F Het
Lrrk2 T A 15: 91,749,840 I1380K possibly damaging Het
Lvrn T G 18: 46,884,439 I612S probably damaging Het
Lyst T C 13: 13,637,823 L940P probably benign Het
Man2a2 T A 7: 80,356,353 M996L probably benign Het
Map3k3 T A 11: 106,151,034 I413N probably damaging Het
Map4k5 A G 12: 69,816,393 V629A probably benign Het
Mapre2 A G 18: 23,890,924 E325G unknown Het
Mbnl1 A G 3: 60,613,294 N101S probably benign Het
Meltf T A 16: 31,885,051 C199S probably damaging Het
Mmab T C 5: 114,436,789 E141G probably benign Het
Mtus2 T C 5: 148,313,407 L1317P Het
Muc6 T A 7: 141,637,870 T2297S possibly damaging Het
Myom2 A T 8: 15,108,399 K784* probably null Het
Nek1 A G 8: 61,124,123 E1118G probably benign Het
Nrtn A G 17: 56,751,416 V195A probably damaging Het
Nsd3 G A 8: 25,714,203 V420I Het
Olfr1094 A G 2: 86,828,754 M1V probably null Het
Olfr1451 T A 19: 12,999,619 I211N probably damaging Het
Olfr205 T C 16: 59,329,402 I36V probably benign Het
Olfr522 G A 7: 140,162,320 T210I probably damaging Het
Olfr618 A T 7: 103,598,018 Q234L probably benign Het
Olfr677 T C 7: 105,057,074 L276P possibly damaging Het
Olfr820 T C 10: 130,017,418 I19T probably benign Het
Olfr923 A T 9: 38,827,718 H3L probably benign Het
Pde10a G T 17: 8,801,878 A216S unknown Het
Phldb2 T C 16: 45,824,884 T400A possibly damaging Het
Pkd1l1 T A 11: 8,865,502 T1920S Het
Ptgs2 T A 1: 150,105,668 N567K probably benign Het
Pwp1 T A 10: 85,876,506 D141E probably damaging Het
Rab3ip T C 10: 116,918,763 E296G probably null Het
Rb1cc1 A G 1: 6,244,115 K337R probably benign Het
Rbp3 A G 14: 33,955,520 D475G probably damaging Het
Ric3 T C 7: 109,038,790 E253G possibly damaging Het
Rictor A T 15: 6,768,081 N306I possibly damaging Het
Rnf214 A T 9: 45,899,843 V174E possibly damaging Het
Robo3 A G 9: 37,429,604 F124S probably damaging Het
Rrad A G 8: 104,628,692 F228S probably damaging Het
Scn3a A T 2: 65,461,251 M1717K probably damaging Het
Scn3b A G 9: 40,282,433 D152G probably benign Het
Scn5a C A 9: 119,486,737 R1635L probably damaging Het
Sec61b A G 4: 47,483,049 Y93C probably damaging Het
Shprh T A 10: 11,166,491 Y739* probably null Het
Skor2 C T 18: 76,858,681 H33Y unknown Het
Slc26a7 T C 4: 14,519,496 N508S probably benign Het
Slc7a12 A G 3: 14,499,300 I349V possibly damaging Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Sltm C T 9: 70,573,559 A231V unknown Het
Smg1 A G 7: 118,212,985 S52P unknown Het
Soga1 G A 2: 157,060,262 R278C probably damaging Het
Sorl1 A G 9: 42,046,597 Y584H probably damaging Het
Ssbp1 T A 6: 40,478,034 S142R probably benign Het
Stard3 A G 11: 98,379,971 probably null Het
Strn3 G T 12: 51,627,517 H531N possibly damaging Het
Stx17 A G 4: 48,180,739 T195A probably damaging Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Tmed5 A C 5: 108,132,234 probably null Het
Tmem132a C T 19: 10,861,596 R494H probably benign Het
Tom1 A G 8: 75,060,549 K406E probably benign Het
Trav5d-4 A T 14: 53,002,016 N43Y probably damaging Het
Trbv19 G T 6: 41,179,011 K105N possibly damaging Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Trp53bp2 T A 1: 182,448,813 N786K probably benign Het
Trpc3 A G 3: 36,651,534 M504T probably benign Het
Ttc28 A T 5: 111,223,226 M545L probably benign Het
Uggt1 A C 1: 36,165,546 V996G possibly damaging Het
Vmn2r65 G A 7: 84,940,672 Q679* probably null Het
Wdfy4 T C 14: 32,970,876 I2958V Het
Zbtb37 C T 1: 161,020,270 S389N possibly damaging Het
Zfp235 T C 7: 24,142,244 V696A possibly damaging Het
Zzef1 T A 11: 72,874,906 C1420S probably damaging Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7311:2410089E03Rik UTSW 15 8180915 missense probably damaging 1.00
R7374:2410089E03Rik UTSW 15 8247247 missense unknown
R7446:2410089E03Rik UTSW 15 8232080 missense probably damaging 0.98
R7539:2410089E03Rik UTSW 15 8201244 missense probably benign 0.19
R7543:2410089E03Rik UTSW 15 8225392 missense unknown
R7558:2410089E03Rik UTSW 15 8225367 missense unknown
R7629:2410089E03Rik UTSW 15 8227067 nonsense probably null
R7635:2410089E03Rik UTSW 15 8226920 missense probably benign 0.01
R7644:2410089E03Rik UTSW 15 8223127 missense probably benign 0.00
R7705:2410089E03Rik UTSW 15 8182252 missense probably damaging 1.00
R7752:2410089E03Rik UTSW 15 8269706 missense unknown
R7754:2410089E03Rik UTSW 15 8243826 missense possibly damaging 0.53
R7757:2410089E03Rik UTSW 15 8252227 missense unknown
R7836:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7875:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7901:2410089E03Rik UTSW 15 8269706 missense unknown
R7983:2410089E03Rik UTSW 15 8221815 missense probably benign 0.01
R8030:2410089E03Rik UTSW 15 8230303 missense probably damaging 1.00
R8088:2410089E03Rik UTSW 15 8186318 missense probably benign 0.00
R8231:2410089E03Rik UTSW 15 8219027 missense probably benign 0.16
R8443:2410089E03Rik UTSW 15 8201151 missense probably benign 0.03
R8480:2410089E03Rik UTSW 15 8187458 missense possibly damaging 0.63
R8693:2410089E03Rik UTSW 15 8229008 missense probably benign 0.15
R8785:2410089E03Rik UTSW 15 8174760 missense probably benign 0.39
R8791:2410089E03Rik UTSW 15 8187260 missense probably damaging 1.00
R8822:2410089E03Rik UTSW 15 8171778 missense probably damaging 1.00
R8831:2410089E03Rik UTSW 15 8182136 missense probably benign 0.09
R8932:2410089E03Rik UTSW 15 8194375 missense probably damaging 1.00
R8968:2410089E03Rik UTSW 15 8201281 missense possibly damaging 0.84
R8973:2410089E03Rik UTSW 15 8203793 missense probably damaging 1.00
R9036:2410089E03Rik UTSW 15 8223138 missense possibly damaging 0.63
R9134:2410089E03Rik UTSW 15 8199232 missense probably damaging 0.99
R9197:2410089E03Rik UTSW 15 8251052 missense unknown
R9259:2410089E03Rik UTSW 15 8203303 missense possibly damaging 0.82
R9269:2410089E03Rik UTSW 15 8219016 missense probably damaging 0.97
R9294:2410089E03Rik UTSW 15 8203327 missense probably benign 0.00
R9328:2410089E03Rik UTSW 15 8186208 missense probably damaging 1.00
R9680:2410089E03Rik UTSW 15 8202301 missense possibly damaging 0.68
R9721:2410089E03Rik UTSW 15 8225409 missense unknown
R9779:2410089E03Rik UTSW 15 8201302 missense possibly damaging 0.93
R9780:2410089E03Rik UTSW 15 8228639 missense probably benign 0.00
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Z1177:2410089E03Rik UTSW 15 8174972 missense probably damaging 1.00
Z1177:2410089E03Rik UTSW 15 8209989 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGTTCGATATTGTCAAGGAAGG -3'
(R):5'- AAGAGCTTTACAGTATTTGCGG -3'

Sequencing Primer
(F):5'- AAGGAAGATTGGAGTTTGCATCTATG -3'
(R):5'- TGAGCCTTATCAAGTGGCCCATG -3'
Posted On 2022-08-09