Incidental Mutation 'R9563:Espl1'
ID 721280
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9563 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102228233 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1669 (I1669N)
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect possibly damaging
Transcript: ENSMUST00000064924
AA Change: I1669N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I1669N

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229050
AA Change: I1669N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000229942
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,645,009 (GRCm39) D953E probably damaging Het
Acod1 A C 14: 103,287,109 (GRCm39) Y80S probably damaging Het
Actr5 A G 2: 158,470,135 (GRCm39) D255G probably damaging Het
Akna A G 4: 63,312,944 (GRCm39) V393A probably damaging Het
Amotl1 T C 9: 14,473,513 (GRCm39) K562R possibly damaging Het
Amz1 T A 5: 140,738,133 (GRCm39) D464E probably damaging Het
Anapc1 G A 2: 128,505,980 (GRCm39) Q619* probably null Het
Arfgef3 C T 10: 18,522,275 (GRCm39) G584R probably damaging Het
Armt1 AC A 10: 4,400,848 (GRCm39) probably null Het
Atr G C 9: 95,802,833 (GRCm39) V1832L probably damaging Het
Bsn T C 9: 107,984,616 (GRCm39) D374G Het
Cap1 A G 4: 122,758,505 (GRCm39) V225A probably benign Het
Cc2d1a A G 8: 84,863,758 (GRCm39) S562P probably benign Het
Ccdc30 T C 4: 119,250,821 (GRCm39) N141S possibly damaging Het
Cdc42bpb A G 12: 111,265,762 (GRCm39) V1390A possibly damaging Het
Cdc42ep1 A T 15: 78,733,782 (GRCm39) H294L probably benign Het
Col6a6 C A 9: 105,572,952 (GRCm39) G2185C probably benign Het
Col7a1 T C 9: 108,791,809 (GRCm39) V1232A unknown Het
Copb1 A G 7: 113,836,034 (GRCm39) I449T possibly damaging Het
Cplane1 T G 15: 8,216,563 (GRCm39) L594V probably benign Het
Ctdsp2 A G 10: 126,832,040 (GRCm39) D216G probably damaging Het
Cttnbp2 T A 6: 18,367,382 (GRCm39) K1645N probably benign Het
Cttnbp2 A T 6: 18,427,467 (GRCm39) L738* probably null Het
Cul9 T A 17: 46,820,897 (GRCm39) T1927S probably benign Het
Cyfip2 A G 11: 46,151,707 (GRCm39) C531R probably benign Het
Cyp2j6 A G 4: 96,414,245 (GRCm39) I340T probably damaging Het
Daam1 A G 12: 71,992,251 (GRCm39) E322G unknown Het
Dab2ip T A 2: 35,609,915 (GRCm39) L710* probably null Het
Degs1l G T 1: 180,882,810 (GRCm39) V191F possibly damaging Het
Dph1 T C 11: 75,076,825 (GRCm39) T60A possibly damaging Het
Eme1 T C 11: 94,541,339 (GRCm39) D161G probably benign Het
Epha3 C T 16: 63,366,510 (GRCm39) G980D possibly damaging Het
Eri3 T A 4: 117,422,013 (GRCm39) V136E probably benign Het
Exoc6 T C 19: 37,588,071 (GRCm39) I568T probably damaging Het
F3 T A 3: 121,527,822 (GRCm39) L85H Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fbxw14 T C 9: 109,106,335 (GRCm39) Y234C probably benign Het
Fbxw25 T A 9: 109,483,676 (GRCm39) N179Y Het
Foxr1 T A 9: 44,352,199 (GRCm39) probably benign Het
Gas8 T A 8: 124,263,179 (GRCm39) V452E possibly damaging Het
Gdpd4 T C 7: 97,649,369 (GRCm39) V450A probably damaging Het
Greb1 T C 12: 16,774,824 (GRCm39) Y191C probably benign Het
H3c11 T C 13: 21,967,221 (GRCm39) D107G probably damaging Het
Haus3 G A 5: 34,325,300 (GRCm39) R120W probably benign Het
Herc1 G T 9: 66,294,193 (GRCm39) probably null Het
Hyal2 T C 9: 107,447,844 (GRCm39) W166R probably damaging Het
Inka1 T A 9: 107,861,488 (GRCm39) Y276F probably benign Het
Itga7 C T 10: 128,789,669 (GRCm39) A1003V probably damaging Het
Itga8 T A 2: 12,165,219 (GRCm39) I797F possibly damaging Het
Kank2 T C 9: 21,705,852 (GRCm39) T389A possibly damaging Het
Kcnb2 T A 1: 15,779,737 (GRCm39) I203N probably damaging Het
Kif21b T A 1: 136,077,166 (GRCm39) L396Q probably damaging Het
Kng1 T G 16: 22,879,170 (GRCm39) I78S probably damaging Het
Ldlrad4 T C 18: 68,387,551 (GRCm39) S288P probably benign Het
Lmntd2 A G 7: 140,790,701 (GRCm39) S516P Het
Lrp1b T A 2: 41,185,711 (GRCm39) I1449F Het
Lrrk2 T A 15: 91,634,043 (GRCm39) I1380K possibly damaging Het
Lvrn T G 18: 47,017,506 (GRCm39) I612S probably damaging Het
Lyst T C 13: 13,812,408 (GRCm39) L940P probably benign Het
Man2a2 T A 7: 80,006,101 (GRCm39) M996L probably benign Het
Map3k3 T A 11: 106,041,860 (GRCm39) I413N probably damaging Het
Map4k5 A G 12: 69,863,167 (GRCm39) V629A probably benign Het
Mapre2 A G 18: 24,023,981 (GRCm39) E325G unknown Het
Mbnl1 A G 3: 60,520,715 (GRCm39) N101S probably benign Het
Meltf T A 16: 31,703,869 (GRCm39) C199S probably damaging Het
Mmab T C 5: 114,574,850 (GRCm39) E141G probably benign Het
Mtcl2 G A 2: 156,902,182 (GRCm39) R278C probably damaging Het
Mtus2 T C 5: 148,250,217 (GRCm39) L1317P Het
Muc6 T A 7: 141,217,783 (GRCm39) T2297S possibly damaging Het
Myom2 A T 8: 15,158,399 (GRCm39) K784* probably null Het
Nek1 A G 8: 61,577,157 (GRCm39) E1118G probably benign Het
Nrtn A G 17: 57,058,416 (GRCm39) V195A probably damaging Het
Nsd3 G A 8: 26,204,230 (GRCm39) V420I Het
Or52e4 T C 7: 104,706,281 (GRCm39) L276P possibly damaging Het
Or52z13 A T 7: 103,247,225 (GRCm39) Q234L probably benign Het
Or5ac23 T C 16: 59,149,765 (GRCm39) I36V probably benign Het
Or5b99 T A 19: 12,976,983 (GRCm39) I211N probably damaging Het
Or5t9 A G 2: 86,659,098 (GRCm39) M1V probably null Het
Or6ae1 G A 7: 139,742,233 (GRCm39) T210I probably damaging Het
Or6c33 T C 10: 129,853,287 (GRCm39) I19T probably benign Het
Or8b56 A T 9: 38,739,014 (GRCm39) H3L probably benign Het
Pde10a G T 17: 9,020,710 (GRCm39) A216S unknown Het
Phldb2 T C 16: 45,645,247 (GRCm39) T400A possibly damaging Het
Pkd1l1 T A 11: 8,815,502 (GRCm39) T1920S Het
Ptgs2 T A 1: 149,981,419 (GRCm39) N567K probably benign Het
Pwp1 T A 10: 85,712,370 (GRCm39) D141E probably damaging Het
Rab3ip T C 10: 116,754,668 (GRCm39) E296G probably null Het
Rb1cc1 A G 1: 6,314,339 (GRCm39) K337R probably benign Het
Rbp3 A G 14: 33,677,477 (GRCm39) D475G probably damaging Het
Ric3 T C 7: 108,637,997 (GRCm39) E253G possibly damaging Het
Rictor A T 15: 6,797,562 (GRCm39) N306I possibly damaging Het
Rnf214 A T 9: 45,811,141 (GRCm39) V174E possibly damaging Het
Robo3 A G 9: 37,340,900 (GRCm39) F124S probably damaging Het
Rrad A G 8: 105,355,324 (GRCm39) F228S probably damaging Het
Scn3a A T 2: 65,291,595 (GRCm39) M1717K probably damaging Het
Scn3b A G 9: 40,193,729 (GRCm39) D152G probably benign Het
Scn5a C A 9: 119,315,803 (GRCm39) R1635L probably damaging Het
Sec61b A G 4: 47,483,049 (GRCm39) Y93C probably damaging Het
Shprh T A 10: 11,042,235 (GRCm39) Y739* probably null Het
Skor2 C T 18: 76,946,376 (GRCm39) H33Y unknown Het
Slc26a7 T C 4: 14,519,496 (GRCm39) N508S probably benign Het
Slc7a12 A G 3: 14,564,360 (GRCm39) I349V possibly damaging Het
Slit1 T C 19: 41,596,874 (GRCm39) Y1075C probably damaging Het
Sltm C T 9: 70,480,841 (GRCm39) A231V unknown Het
Smg1 A G 7: 117,812,208 (GRCm39) S52P unknown Het
Sorl1 A G 9: 41,957,893 (GRCm39) Y584H probably damaging Het
Spmip2 A T 3: 79,356,616 (GRCm39) M140L probably benign Het
Ssbp1 T A 6: 40,454,968 (GRCm39) S142R probably benign Het
Stard3 A G 11: 98,270,797 (GRCm39) probably null Het
Strn3 G T 12: 51,674,300 (GRCm39) H531N possibly damaging Het
Stx17 A G 4: 48,180,739 (GRCm39) T195A probably damaging Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Tmed5 A C 5: 108,280,100 (GRCm39) probably null Het
Tmem132a C T 19: 10,838,960 (GRCm39) R494H probably benign Het
Tom1 A G 8: 75,787,177 (GRCm39) K406E probably benign Het
Trav5d-4 A T 14: 53,239,473 (GRCm39) N43Y probably damaging Het
Trbv19 G T 6: 41,155,945 (GRCm39) K105N possibly damaging Het
Trim34a C T 7: 103,910,328 (GRCm39) Q377* probably null Het
Trp53bp2 T A 1: 182,276,378 (GRCm39) N786K probably benign Het
Trpc3 A G 3: 36,705,683 (GRCm39) M504T probably benign Het
Ttc28 A T 5: 111,371,092 (GRCm39) M545L probably benign Het
Uggt1 A C 1: 36,204,627 (GRCm39) V996G possibly damaging Het
Vmn2r65 G A 7: 84,589,880 (GRCm39) Q679* probably null Het
Wdfy4 T C 14: 32,692,833 (GRCm39) I2958V Het
Zbtb37 C T 1: 160,847,840 (GRCm39) S389N possibly damaging Het
Zfp235 T C 7: 23,841,669 (GRCm39) V696A possibly damaging Het
Zzef1 T A 11: 72,765,732 (GRCm39) C1420S probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATCCTTATGCCACTGCG -3'
(R):5'- GGCCAGGTAAACTAAGCAATATC -3'

Sequencing Primer
(F):5'- TTGCACCGACAGCTCAG -3'
(R):5'- AATATCTTAAGCTCATCTACTCAGCC -3'
Posted On 2022-08-09